Nomenclature of Rad51A1 and Rad51A2 (Guo-Ling Nan, 22 September 2011)
Rad51A1 and Rad51A2 were previously named Rad51A and Rad51B, respectively. Please note that the old names are used in three places in the paper: Table 2, Additional file 4, and Additional file 11.
read full comment
BMC Plant Biology 2010, 10:195doi:10.1186/1471-2229-10-195 Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait
CORRECTION: In the Methods, under the subsection FAD2-1B allele specific molecular marker assay, incorrect primer sequences were inadvertently listed: Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'-ACTGCATCGAATAATACAAGCC-3' at 2 μM final concentration, and 5'-TGATATTGTCCCGTCCAGC-3' at 5 μM final concentration).
The correct sentence should read: Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'- GGTTCTCCAAGGTTGCATTCTTACT -3' at 2 μM final concentration, and 5'- AGGGTTGTTCAGGTACTTGGTGT -3' at 5 μM final...
read full comment
Mispelled reference (David Dauvillée, 08 July 2011)
The reference 65 is mispelled Dumeza S, Wattebleda F, Dauvilleea D, Delvallea D, Planchotb V, Ball SG, D'Hulsta C: Mutants of Arabidopsis .... should be
In the results subsection of the abstract the first sentence should read: EST libraries were generated by SSH from root and shoot tissues of ICC4958 (drought tolerant) and ICC 1882 (drought susceptible) exposed to terminal drought conditions by the dry down method.
read full comment
Are those plants clones? (Isidro Ovando, 15 March 2011)
I'm surprised by the results, specifically the follow: ..."A total number of 575 bands were identified by fAFLP analysis of all 162 individuals, out of which only 3 poly morphic bands were detected in 5 plants from China and India. This represents that only 0.52% of bands were polymorphic"..."RAPD, DAMD, SSR...SCAR...all failed to detect a single polymorphism in our samples...
Those results are equivalent to state that J. curcas studied are clones, which is difficult to explain, especially considering that samples came from seeds (...jatropha seeds were collected in five countries on three continents...)
I think the contributions of that investigation are really important about epigenetic variation in this species, but I think too that is unlikely the claim "...all the...
read full comment
We think the following paper wiil be helpfull to the relevant readers.
Wang, L., Xie, W., Chen, Y., Tang, W., Yang, J., Ye, R., Liu, L., Lin, Y., Xu, C., Xiao, J., and Zhang, Q. (2010) A dynamic gene expression atlas covering the entire life cycle of rice. Plant Journal 61: 752-766
Why wasnt the RLK protein abundance measured? (David Lightfoot, 12 November 2010)
Melito et al., 2010 suggested that the RLK at Rhg1 was involved in root development but not the nematode development as shown by others (Ruben et al 2006 Afzal et al., 2008; Srour et al 2010). Sadly, the Melito et al study was flawed by the lack of an analysis of the target RLK protein abundance despite the available antibodies. The antibodies were offered freely and repeatedly to the PI. Stable transgenic soybean show the RLK is indeed a major resistance gene with effects on 3 pests, SCN, F.virguliforme and insect herbivory. See the first reports at Srour Ali , Simmonds Daina , David A Lightfoot (2010) The rhg1/Rfs2 locus isolated in transgenic plants. Plant and Animal Genome Conference Proceedings P704 : Transformation. This message will be updated when the papers in review are published....
read full comment
corrections to the article (Ann Loraine, 04 November 2010)
Dear Readers, The article requires two corrections: First, we included a discussion of an Arabidopsis gene we called SR40. The correct designation is SR45, not SR40. Second, we implied that the ovule library is derived from a single cell type. Ovules actually consist of more than one cell type. Very best wishes, Ann Loraine
Introns could also affect mRNA stability (Deng-Ke Niu, 09 August 2010)
In this paper, the authors said "Introns stimulate gene expression in a wide range of organisms by increasing the levels of mature mRNA, without affecting mRNA stability". Surely, early studies did not observe significant effect of introns on mRNA stability. Those studies were based on a small number of genes. Later genome-wide analyses have shown that the mRNAs of intron-containing genes are more stable than those of intronless genes (1,2). In addition, there is also a experimental study showing that introducing an intron to a gene could enhance its mRNA stability (3).
1. Wang HF, Feng L and Niu DK (2007). Relationship between mRNA stability and intron presence. Biochemical and Biophysical Research Communications 354: 203-208.
The oligo (5'-TSAAGAAAGCWWARGAGCTYWCCG) used to amplify fragments of MADS-box-like transcription factors by 3’-RACE-PCR was provided by Andrea Haerter (University of Jena) and is published here without her consent. The authors hereby explicitly exclude the oligo and its sequence from any rights that were initially obtained under the terms of the Creative Commons Attribution 2.0 Generic License. This comment is posted here with full agreement of Andrea Haerter. read full comment
Correct nomenclature of Na-thionin (cbgowda rayapuram, 23 January 2009)
Lately, a correction in the nomenclature of Na-thionin has been noticed by one of the readers of BMC Plant Biology (Dr. Sonny Larsson). It seems that there is a confusion about the peptide nomenclature (thionins)in the NCBI databases. And, as per the latest report,thionin (or PR-13) family of defense related plant peptides actually belong to plant defensin (or PR-12) family member. It has been reported that the 3D structure of plant thionin is very similar to defensins from insects and mammals (to a lesser degree). Hence the correct nomenclature for Na-thionin would be Na-defensin. We request the readers to note this change. We thank Dr Sonny Larsson for noticing this error and helping us to correct it. Further details on the naming and classification of...
read full comment
Correction to Table 4 (James Ketudat Cairns, 29 September 2008)
In Table 4, the last two p-nitrophenyl glycosides should be alpha-linked (pNP-alpha-L-arabinoside and pNP-alpha-D-galactoside). The alpha's were accidently replaced by beta's during editing and I failed to catch it. I apologize to the readers for any confusion.
read full comment
Mirror site for BBGD (Nadim Alkharouf, 22 May 2007)
Due to recent problems with the server hosting BBGD at the USDA, a mirror site has been created at Towson University. The URL to access this site is:http://bioinformatics.towson.edu/BBGD/Please let us know if you have any problems accessing the database.
read full comment
Addendum to clarify specificity of coordination (J Kenneth Hoober, 15 January 2003)
Addendum to Eggink, L.L., Park, H. and Hoober, J.K. 2001. The role of chlorophyll b in photosynthesis: Hypothesis. BMC Plant Biology 1:2.This paper proposed that specificity of binding of chlorophyll (Chl) a and b in the light-harvesting complexes (LHCs) of thylakoid membranes in chloroplasts is a consequence of the stronger Lewis acid property of the Mg in Chl b. Also, the stronger coordination bonds formed between Chl b and apoproteins would facilitate assembly and enhance stability of LHCs. Oxidation of the 7-methyl group of Chl a to the electronegative formyl group causes redistribution of the tetrapyrrole macrocycle π electrons toward the periphery of the molecule. As a result, the central Mg in Chl b has a more positive point charge than that in Chl a and would be expected...
read full comment
RSS
Latest comments
Nomenclature of Rad51A1 and Rad51A2 (Guo-Ling Nan, 22 September 2011)
Rad51A1 and Rad51A2 were previously named Rad51A and Rad51B, respectively. Please note that the old names are used in three places in the paper: Table 2, Additional file 4, and Additional file 11. read full comment
Comment on: Nan et al. BMC Plant Biology, 11:120
CORRECTION (K Bilyeu, 07 September 2011)
BMC Plant Biology 2010, 10:195doi:10.1186/1471-2229-10-195
Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait
CORRECTION:
In the Methods, under the subsection FAD2-1B allele specific molecular marker assay, incorrect primer sequences were inadvertently listed:
Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'-ACTGCATCGAATAATACAAGCC-3' at 2 μM final concentration, and 5'-TGATATTGTCCCGTCCAGC-3' at 5 μM final concentration).
The correct sentence should read:
Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'- GGTTCTCCAAGGTTGCATTCTTACT -3' at 2 μM final concentration, and 5'- AGGGTTGTTCAGGTACTTGGTGT -3' at 5 μM final... read full comment
Comment on: Pham et al. BMC Plant Biology, 10:195
Mispelled reference (David Dauvillée, 08 July 2011)
The reference 65 is mispelled
Dumeza S, Wattebleda F, Dauvilleea D, Delvallea D, Planchotb V, Ball SG, D'Hulsta C: Mutants of Arabidopsis ....
should be
Dumez S, Wattebled F, Dauvillee D, Delvalle D, Planchot V, Ball SG, D'Hulst C: Mutants of Arabidopsis ..... read full comment
Comment on: Xia et al. BMC Plant Biology, 11:95
Correction (R Srinivasan, 02 June 2011)
In the results subsection of the abstract the first sentence should read:
EST libraries were generated by SSH from root and shoot tissues of ICC4958 (drought tolerant) and ICC 1882 (drought susceptible) exposed to terminal drought conditions by the dry down method. read full comment
Comment on: Deokar et al. BMC Plant Biology, 11:70
Are those plants clones? (Isidro Ovando, 15 March 2011)
I'm surprised by the results, specifically the follow: ..."A total number of 575 bands were identified by fAFLP analysis of all 162 individuals, out of which only 3 poly morphic bands were detected in 5 plants from China and India. This represents that only 0.52% of bands were polymorphic"..."RAPD, DAMD, SSR...SCAR...all failed to detect a single polymorphism in our samples...
Those results are equivalent to state that J. curcas studied are clones, which is difficult to explain, especially considering that samples came from seeds (...jatropha seeds were collected in five countries on three continents...)
I think the contributions of that investigation are really important about epigenetic variation in this species, but I think too that is unlikely the claim "...all the... read full comment
Comment on: Yi et al. BMC Plant Biology, 10:259
relevant paper (Lingqiang Wang, 13 January 2011)
We think the following paper wiil be helpfull to the relevant readers.
Wang, L., Xie, W., Chen, Y., Tang, W., Yang, J., Ye, R., Liu, L., Lin, Y., Xu, C., Xiao, J., and Zhang, Q. (2010) A dynamic gene expression atlas covering the entire life cycle of rice. Plant Journal 61: 752-766
read full comment
Comment on: Wang et al. BMC Plant Biology, 10:282
Why wasnt the RLK protein abundance measured? (David Lightfoot, 12 November 2010)
Melito et al., 2010 suggested that the RLK at Rhg1 was involved in root development but not the nematode development as shown by others (Ruben et al 2006 Afzal et al., 2008; Srour et al 2010). Sadly, the Melito et al study was flawed by the lack of an analysis of the target RLK protein abundance despite the available antibodies. The antibodies were offered freely and repeatedly to the PI. Stable transgenic soybean show the RLK is indeed a major resistance gene with effects on 3 pests, SCN, F.virguliforme and insect herbivory. See the first reports at Srour Ali , Simmonds Daina , David A Lightfoot (2010) The rhg1/Rfs2 locus isolated in transgenic plants. Plant and Animal Genome Conference Proceedings P704 : Transformation. This message will be updated when the papers in review are published.... read full comment
Comment on: Melito et al. BMC Plant Biology, 10:104
corrections to the article (Ann Loraine, 04 November 2010)
Dear Readers,
The article requires two corrections:
First, we included a discussion of an Arabidopsis gene we called SR40. The correct designation is SR45, not SR40.
Second, we implied that the ovule library is derived from a single cell type. Ovules actually consist of more than one cell type.
Very best wishes,
Ann Loraine
read full comment
Comment on: English et al. BMC Plant Biology, 10:102
Introns could also affect mRNA stability (Deng-Ke Niu, 09 August 2010)
In this paper, the authors said "Introns stimulate gene expression in a wide range of organisms by increasing the levels of mature mRNA, without affecting mRNA stability". Surely, early studies did not observe significant effect of introns on mRNA stability. Those studies were based on a small number of genes. Later genome-wide analyses have shown that the mRNAs of intron-containing genes are more stable than those of intronless genes (1,2). In addition, there is also a experimental study showing that introducing an intron to a gene could enhance its mRNA stability (3).
1. Wang HF, Feng L and Niu DK (2007). Relationship between mRNA stability and intron presence. Biochemical and Biophysical Research Communications 354: 203-208.
2. Narsai R, Howell KA, Millar... read full comment
Comment on: Akua et al. BMC Plant Biology, 10:93
Useful for molecular breeding (Lily Guo, 05 July 2010)
It would be helpful for their future use in molecular breeding as new promoters of stress-resistance genes from desert plants. read full comment
Comment on: Guo et al. BMC Plant Biology, 10:18
Authors´ comment (Thomas Borchert, 12 May 2010)
The oligo (5'-TSAAGAAAGCWWARGAGCTYWCCG) used to amplify fragments of MADS-box-like transcription factors by 3’-RACE-PCR was provided by Andrea Haerter (University of Jena) and is published here without her consent. The authors hereby explicitly exclude the oligo and its sequence from any rights that were initially obtained under the terms of the Creative Commons Attribution 2.0 Generic License. This comment is posted here with full agreement of Andrea Haerter.
read full comment
Comment on: Borchert et al. BMC Plant Biology, 9:148
Correct nomenclature of Na-thionin (cbgowda rayapuram, 23 January 2009)
Lately, a correction in the nomenclature of Na-thionin has been noticed by one of the readers of BMC Plant Biology (Dr. Sonny Larsson). It seems that there is a confusion about the peptide nomenclature (thionins)in the NCBI databases. And, as per the latest report,thionin (or PR-13) family of defense related plant peptides actually belong to plant defensin (or PR-12) family member. It has been reported that the 3D structure of plant thionin is very similar to defensins from insects and mammals (to a lesser degree). Hence the correct nomenclature for Na-thionin would be Na-defensin. We request the readers to note this change. We thank Dr Sonny Larsson for noticing this error and helping us to correct it. Further details on the naming and classification of... read full comment
Comment on: Rayapuram et al. BMC Plant Biology, 8:109
Correction to Table 4 (James Ketudat Cairns, 29 September 2008)
In Table 4, the last two p-nitrophenyl glycosides should be alpha-linked (pNP-alpha-L-arabinoside and pNP-alpha-D-galactoside). The alpha's were accidently replaced by beta's during editing and I failed to catch it. I apologize to the readers for any confusion. read full comment
Comment on: Tanthanuch et al. BMC Plant Biology, 8:84
Mirror site for BBGD (Nadim Alkharouf, 22 May 2007)
Due to recent problems with the server hosting BBGD at the USDA, a mirror site has been created at Towson University. The URL to access this site is:http://bioinformatics.towson.edu/BBGD/Please let us know if you have any problems accessing the database. read full comment
Comment on: Alkharouf et al. BMC Plant Biology, 7:5
Addendum to clarify specificity of coordination (J Kenneth Hoober, 15 January 2003)
Addendum to Eggink, L.L., Park, H. and Hoober, J.K. 2001. The role of chlorophyll b in photosynthesis: Hypothesis. BMC Plant Biology 1:2.This paper proposed that specificity of binding of chlorophyll (Chl) a and b in the light-harvesting complexes (LHCs) of thylakoid membranes in chloroplasts is a consequence of the stronger Lewis acid property of the Mg in Chl b. Also, the stronger coordination bonds formed between Chl b and apoproteins would facilitate assembly and enhance stability of LHCs. Oxidation of the 7-methyl group of Chl a to the electronegative formyl group causes redistribution of the tetrapyrrole macrocycle π electrons toward the periphery of the molecule. As a result, the central Mg in Chl b has a more positive point charge than that in Chl a and would be expected... read full comment
Comment on: Eggink et al. BMC Plant Biology, 1:2