Submit a manuscript Sign up for article alerts Contact us

RSS

Latest comments

Change of Affiliation for Author (Astha Ramaiya, 22 May 2015)

Zoe Hildon's affiliation is : Saw Swee Hock School of Public Health, National University of Singapore, Tahir Foundation Building, 12 Science Drive 2, #09-01R, Singapore 117549 read full comment

Comment on: Ramaiya et al. BMC Research Notes, 7:750

Recognition (Christopher Cammiss, 01 May 2015)

My name is Chris Cammiss and I have just read your... read full comment

Comment on: Kinnear et al. BMC Research Notes, 7:854

New web address (Jizu Zhi, 29 April 2015)

This application has been moved to http://osa-bioinform.uhmc.sunysb.edu/mlpa2/cgi-bin/mlpa.cgi   read full comment

Comment on: Zhi BMC Research Notes, 3:137

New repository for source code (Stinus Lindgreen, 17 March 2015)

I am the author of the paper "AdapterRemoval: easy cleaning of next-generation sequencing reads". When the paper was published, I made the source code available using Google Code. However, Google is shutting down this service in August 2015, so I have migrated the code to GitHub instead: https://github.com/slindgreen/AdapterRemoval
You might also be interested in the updated version 2 of the program available here: https://github.com/mikkelschubert/adapterremoval Thanks, Stinus Lindgreen read full comment

Comment on: Lindgreen BMC Research Notes, 5:337

Corrections to equations 16 and 17. (Hui Kian Ho, 07 January 2015)

It was brought to our attention that equations 16 and 17 (the equations for recall and precision) contain typographic errors and should be amended as follows: Equation 16: recall = TP / (TP + FN) Equation 17: precision = TP / (TP + FP) These amendments do not change the results or conclusions of this article. read full comment

Comment on: Ho et al. BMC Research Notes, 5:391

another email address (Tara Nath Gaire, 17 October 2014)

taranath.gaire@gmail.com read full comment

Comment on: Gaire et al. BMC Research Notes, 7:691

Mistake in table 1 (Frank Döring, 17 September 2014)

The description of the lines “ubiquinol” and “ubiquinone” are interchanged which means that the data/level of ubiquinol have to be allocated to ubiquinone and vice versa.  
read full comment

Comment on: Onur et al. BMC Research Notes, 7:427

The limma model is not correct; see the updated paper at Colin's site for a correction. (David Airey, 05 September 2014)

The design in the original paper repeatedly samples 6 flasks over 5 time points, rather than 30 flasks grown to different time points where each flask is sampled once. The latter design might be appropriately analyzed by the limma code presented in the paper, whereas a better comparison for the actual design with the "timecourse" package would be to consider hierarchical designs in limma. The design of the actual experiment is a simple split plot, with the one between subject (flask) factor being strain and the one within subject (flask) factor being time. The fix here is to note the correspondence between the example in section 9.7 of the limma manual. Substitute time for tissue, and flask for subject, and strain for condition and proceed as shown. read full comment

Comment on: Gillespie et al. BMC Research Notes, 3:81

Concerning ‘Type III Monteggia injury with ipsilateral type II Salter Harris injury of the distal radius and ulna in a child’ (James Huntley, 17 April 2014)

Dear... read full comment

Comment on: Williams et al. BMC Research Notes, 7:156

Minor correction to sequence data (Cameron Neylon, 25 March 2014)

In table 1 the generation of two variant β-glucuronidases with increased β-galactosidase activity (labelled as C4.1 and C4.2) is described. Further analysis of the sequencing of these mutants has revealed a minor error in the listed mutation sites. Mutant C4.1 also contains a silent mutation. Mutant C4.2 is missing mutation sites N166T and N412D and the listing of a silent mutation. These make the mutants: C4.1: G245A/K370R/W529L C4.2: V67D/N166T/K370R/N412D/W529L These changes do not affect the overall results and conclusions of our report. Cameron Neylon on behalf of the authors. read full comment

Comment on: Smith et al. BMC Research Notes, 4:138

Positive Proof of Etiological Agent is Absent (Chester Cooper, 25 March 2014)

To be blunt, the central premise of this report is seriously flawed.  The authors claim to have isolated P. marneffei from an AIDS patient in Togo who had never visited the established and delimited endemic region.  If true, this would suggest that the fungus resides elsewhere in the world – a fact that has not been established in the nearly 55 years since this organism was discovered.  Unfortunately, the authors do not unequivocally prove they have isolated P. marneffei from this patient.  While I realize that resources might have been limited to these investigators, the conclusions they state rely on very dubious observations.  They point to the isolation of a fungus that does have... read full comment

Comment on: Patassi et al. BMC Research Notes, 6:506

typo (Jeruza Neyeloff, 10 April 2013)

Dear Vishnu,

You are correct. If you use the formulas from the additional file everything should work fine.

I am glad the paper was helpful and that you've learned from it.

Best regards,

Jeruza Neyeloff read full comment

Comment on: Neyeloff et al. BMC Research Notes, 5:52

Forest Plot:Meta-analyses and Forest plots using a microsoft excel spreadsheet (Vishnu Khanal, 10 March 2013)

Dear... read full comment

Comment on: Neyeloff et al. BMC Research Notes, 5:52

Wrong accession number for EF1A (Pal A. Olsvik, 08 March 2013)

Due to a copy-paste error, the wrong accession number and primer sequences were provided for the EF1A assay in Table 2.

The correct GenBank accession number is: EX722124
Forward primer: CGGTATCCTCAAGCCCAACA
Reverse primer: GTCAGAGACTCGTGGTGCATCT
read full comment

Comment on: Olsvik et al. BMC Research Notes, 1:47

Response to GAPP Comment (Jeffrey Lacasse, 14 December 2012)

We appreciate the response [1] from members of the Global Alliance of Publication Professionals (GAPP) regarding our recent article on ghostwriting [2]. The GAPP website notes that GAPP's aim is to "Provide a timely and credible response to influential stories about medical publication professionals" [3]. The GAPP website is funded by the International Society for Medical Publication Professionals [4], which is in turn funded by pharmaceutical companies [5]. In other words, GAPP's mission is to lobby on behalf of medical writers and publication planners subcontracted by the pharmaceutical industry [6-9]. We appreciate that this is transparent on the GAPP website.... read full comment

Comment on: Lacasse et al. BMC Research Notes, 5:490

Clarification of Role of Professional Medical Writers (Arthur Gertel, 14 December 2012)

Having read with interest the article by Lacasse, et al: Knowledge of undisclosed corporate authorship ('ghostwriting') reduces the perceived credibility of antidepressant research: a randomized vignette study with experienced nurses1, we were concerned that the authors had, by conflating industry sponsorship with ghostwriting, not accurately addressed the perception of credibility that they set out to measure.... read full comment

Comment on: Lacasse et al. BMC Research Notes, 5:490

Great Material for Bookmarking (Debra Maples, 19 November 2012)

Great material for me to use in future blog posts on my website and blog regarding children's health and wellbeing. In particular, I have a section on organizations and charities that promote same. I'm sure I'll be a regular visitor to this site in the future.

Thank you for the excellent article.

Debra @ www.childrenswellbeingblog.com read full comment

Comment on: Bhui et al. BMC Research Notes, 3:188

A new update to this version is available : EasyModeller 4.0 (for both LINUX and WINDOWS) (Kuntal Bhusan, 12 September 2012)

EasyModeller 4.0 introduces a fresh new GUI for Homology Modeling using MODELLER in the backend and available for both Windows and Linux platform. This version has several new features integrating all the goodies of EasyModeller 3.0 which was only available for... read full comment

Comment on: Kuntal et al. BMC Research Notes, 3:226

Correction : Graphs in Figure 2 and Figure 3 are inverted. (Nathalie Hasler-Nguyen, 12 September 2012)

The graph in Figure 2 is the graph in Figure 3 and vice versa. Legends of both figures are correct. read full comment

Comment on: Hasler-Nguyen et al. BMC Research Notes, 5:321

Interesting Case Report but 3 worrying things: (Christopher Weatherburn, 22 August 2012)

1. The case did the rapid testing after unprotected anal sex with the trial subject.
2. Misuse of methamphetamine prior to testing.
3. Divergence of kit used for trial.

I suspect the individual's character is likely to be the main factor that will relate to relatively responsible self-reported post result behaviour.

I have never seen the particular kits but would recommend they include clearer instructions regarding what to do after the result (particularly positive result with contact details for ongoing care). I suspect that for the purposes of your trial these may have been altered. Is this true?

I also suspect an increase use of HIV home test kits could help to destigmatise HIV in future. read full comment

Comment on: Katz et al. BMC Research Notes, 5:440

Not a bug (Adam Szalkowski, 24 May 2012)

Dear Erik,

thank you for your comment but I still do not consider your use case being a bug as you probably swapped the gap opening and gap extension penalties in your command line. The gap opening penalty (-i) is the penalty that is subtracted from the score when a gap is opened and should be at least as large as the extension penalty (-e).

Depending of you definition of opening/extension penalty you probably should have said:
/tmp/swps3 /tmp/matrices/blosum50.mat /tmp/test/query0100.fa /tmp/test/udb1000.fa -j 1 -i -10 -e -3
or
/tmp/swps3 /tmp/matrices/blosum50.mat /tmp/test/query0100.fa /tmp/test/udb1000.fa -j 1 -i -13 -e -3

Best regards,
Adam read full comment

Comment on: Szalkowski et al. BMC Research Notes, 1:107

Correction: Contig identity for the DJ-1 transcript in Figure 6 and Additional file 6 (Ann Burnell, 22 May 2012)

There is an error in the legend for Figure 6. Real-Time Relative qPCR analysis of the expression of some putative stress-response genes in Panagrolaimus superbus following 12 h of desiccation at 98% RH. The contig identity for the DJ-1 transcript assayed in this experiment is incorrect. The correct contig identity for this transcript is PSC04253 and its dbEST Accession Number is GW413264.1.... read full comment

Comment on: Tyson et al. BMC Research Notes, 5:68

SWPS3 algorithm is buggy (Erik Sjölund, 08 May 2012)

A drawback of SWPS3 is that its algorithm is buggy. It sometimes gives the wrong result. For details see

http://diagonalsw.sourceforge.net/#swps3
http://www.sbc.su.se/~esjolund/swps3-bug-report-from-2009-07-26-shellsession.txt

The bug was reported In 2009 to Adam Szalkowski who acknowledged that the bug was reproducible.
As of March 2012 the SWPS3 software still contains the same bug. read full comment

Comment on: Szalkowski et al. BMC Research Notes, 1:107

Corrections for co morbidity with anxiety disorders (Hannie Comijs, 08 March 2012)

The co morbidity rates of anxiety disorders as reported in the paper are not correct. The correct numbers are presented here. In our depressed sample (N=378) 144 persons (38.1%) had a co morbid anxiety disorder. Social phobia (n= 66, 17.5%) was most often present, followed by generalized anxiety disorder (n=37, 9.8%), agoraphobia (n=36, 9.5%), panic disorder with agoraphobia (n= 28, 7.4%), and panic disorder without agoraphobia (n= 26, 6.9%). 11.9% of depressed patients had more than one co morbid anxiety disorder. read full comment

Comment on: Comijs et al. BMC Research Notes, 4:524

XMRV detection (Mark James Robinson, 29 November 2011)

Dear Sir,

You state in your discussion that "Of the remaining 27 publications, 13 studies used Taq or master-mixes likely containing UNG (it was present in 8 studies [2-9] and possibly used in the remaining 5 studies [10-14] that we examined"

As authors of study [11], we would like to clarify that we did not use UNG in our master mix as indicated in the methods section of our publication. We were able to show that our PCR was highly sensitive.

Furthermore, we have been able to detect traces of contaminating murine DNA by nested PCR in several publications (see references below), indicating that PCR inhibition is not an issue in our assay.

References
Robinson et al. Retrovirology 2010, 7:108
Erlwein et al. PLoS One 2011, 6(8):e23484 read full comment

Comment on: Bacich et al. BMC Research Notes, 4:457