RSS

Latest comments

typo (Jeruza Neyeloff, 10 April 2013)

Dear Vishnu,

You are correct. If you use the formulas from the additional file everything should work fine.

I am glad the paper was helpful and that you've learned from it.

Best regards,

Jeruza Neyeloff read full comment

Comment on: Neyeloff et al. BMC Research Notes, 5:52

Forest Plot:Meta-analyses and Forest plots using a microsoft excel spreadsheet

(Vishnu khanal, 10 March 2013)

Dear... read full comment

Comment on: Neyeloff et al. BMC Research Notes, 5:52

Wrong accession number for EF1A (Pal A. Olsvik, 08 March 2013)

Due to a copy-paste error, the wrong accession number and primer sequences were provided for the EF1A assay in Table 2.

The correct GenBank accession number is: EX722124
Forward primer: CGGTATCCTCAAGCCCAACA
Reverse primer: GTCAGAGACTCGTGGTGCATCT
read full comment

Comment on: Olsvik et al. BMC Research Notes, 1:47

Response to GAPP Comment (Jeffrey Lacasse, 14 December 2012)

We appreciate the response [1] from members of the Global Alliance of Publication Professionals (GAPP) regarding our recent article on ghostwriting [2]. The GAPP website notes that GAPP¿s aim is to ¿Provide a timely and credible response to influential stories about medical publication professionals¿ [3]. The GAPP website is funded by the International Society for Medical Publication Professionals [4], which is in turn funded by pharmaceutical companies [5]. In other words, GAPP¿s mission is to lobby on behalf of medical writers and publication planners subcontracted by the pharmaceutical industry [6-9]. We appreciate that this is transparent on the GAPP website.... read full comment

Comment on: Lacasse et al. BMC Research Notes, 5:490

Clarification of Role of Professional Medical Writers (Arthur Gertel, 14 December 2012)

Having read with interest the article by Lacasse, et al: Knowledge of undisclosed corporate authorship (¿ghostwriting¿) reduces the perceived credibility of antidepressant research: a randomized vignette study with experienced nurses1, we were concerned that the authors had, by conflating industry sponsorship with ghostwriting, not accurately addressed the perception of credibility that they set out to measure.... read full comment

Comment on: Lacasse et al. BMC Research Notes, 5:490

Great Material for Bookmarking (Debra Maples, 19 November 2012)

Great material for me to use in future blog posts on my website and blog regarding children's health and wellbeing. In particular, I have a section on organizations and charities that promote same. I'm sure I'll be a regular visitor to this site in the future.

Thank you for the excellent article.

Debra @ www.childrenswellbeingblog.com read full comment

Comment on: Bhui et al. BMC Research Notes, 3:188

A new update to this version is available : EasyModeller 4.0 (for both LINUX and WINDOWS) (Kuntal Bhusan, 12 September 2012)

EasyModeller 4.0 introduces a fresh new GUI for Homology Modeling using MODELLER in the backend and available for both Windows and Linux platform. This version has several new features integrating all the goodies of EasyModeller 3.0 which was only available for... read full comment

Comment on: Kuntal et al. BMC Research Notes, 3:226

Correction : Graphs in Figure 2 and Figure 3 are inverted. (Nathalie Hasler-Nguyen, 12 September 2012)

The graph in Figure 2 is the graph in Figure 3 and vice versa. Legends of both figures are correct. read full comment

Comment on: Hasler-Nguyen et al. BMC Research Notes, 5:321

Interesting Case Report but 3 worrying things: (Christopher Weatherburn, 22 August 2012)

1. The case did the rapid testing after unprotected anal sex with the trial subject.
2. Misuse of methamphetamine prior to testing.
3. Divergence of kit used for trial.

I suspect the individual's character is likely to be the main factor that will relate to relatively responsible self-reported post result behaviour.

I have never seen the particular kits but would recommend they include clearer instructions regarding what to do after the result (particularly positive result with contact details for ongoing care). I suspect that for the purposes of your trial these may have been altered. Is this true?

I also suspect an increase use of HIV home test kits could help to destigmatise HIV in future. read full comment

Comment on: Katz et al. BMC Research Notes, 5:440

Not a bug (Adam Szalkowski, 24 May 2012)

Dear Erik,

thank you for your comment but I still do not consider your use case being a bug as you probably swapped the gap opening and gap extension penalties in your command line. The gap opening penalty (-i) is the penalty that is subtracted from the score when a gap is opened and should be at least as large as the extension penalty (-e).

Depending of you definition of opening/extension penalty you probably should have said:
/tmp/swps3 /tmp/matrices/blosum50.mat /tmp/test/query0100.fa /tmp/test/udb1000.fa -j 1 -i -10 -e -3
or
/tmp/swps3 /tmp/matrices/blosum50.mat /tmp/test/query0100.fa /tmp/test/udb1000.fa -j 1 -i -13 -e -3

Best regards,
Adam read full comment

Comment on: Szalkowski et al. BMC Research Notes, 1:107

Correction: Contig identity for the DJ-1 transcript in Figure 6 and Additional file 6 (Ann Burnell, 22 May 2012)

There is an error in the legend for Figure 6. Real-Time Relative qPCR analysis of the expression of some putative stress-response genes in Panagrolaimus superbus following 12 h of desiccation at 98% RH. The contig identity for the DJ-1 transcript assayed in this experiment is incorrect. The correct contig identity for this transcript is PSC04253 and its dbEST Accession Number is GW413264.1.... read full comment

Comment on: Tyson et al. BMC Research Notes, 5:68

SWPS3 algorithm is buggy (Erik Sjölund, 08 May 2012)

A drawback of SWPS3 is that its algorithm is buggy. It sometimes gives the wrong result. For details see

http://diagonalsw.sourceforge.net/#swps3
http://www.sbc.su.se/~esjolund/swps3-bug-report-from-2009-07-26-shellsession.txt

The bug was reported In 2009 to Adam Szalkowski who acknowledged that the bug was reproducible.
As of March 2012 the SWPS3 software still contains the same bug. read full comment

Comment on: Szalkowski et al. BMC Research Notes, 1:107

Corrections for co morbidity with anxiety disorders (Hannie Comijs, 08 March 2012)

The co morbidity rates of anxiety disorders as reported in the paper are not correct. The correct numbers are presented here. In our depressed sample (N=378) 144 persons (38.1%) had a co morbid anxiety disorder. Social phobia (n= 66, 17.5%) was most often present, followed by generalized anxiety disorder (n=37, 9.8%), agoraphobia (n=36, 9.5%), panic disorder with agoraphobia (n= 28, 7.4%), and panic disorder without agoraphobia (n= 26, 6.9%). 11.9% of depressed patients had more than one co morbid anxiety disorder. read full comment

Comment on: Comijs et al. BMC Research Notes, 4:524

XMRV detection (Mark James Robinson, 29 November 2011)

Dear Sir,

You state in your discussion that "Of the remaining 27 publications, 13 studies used Taq or master-mixes likely containing UNG (it was present in 8 studies [2-9] and possibly used in the remaining 5 studies [10-14] that we examined"

As authors of study [11], we would like to clarify that we did not use UNG in our master mix as indicated in the methods section of our publication. We were able to show that our PCR was highly sensitive.

Furthermore, we have been able to detect traces of contaminating murine DNA by nested PCR in several publications (see references below), indicating that PCR inhibition is not an issue in our assay.

References
Robinson et al. Retrovirology 2010, 7:108
Erlwein et al. PLoS One 2011, 6(8):e23484 read full comment

Comment on: Bacich et al. BMC Research Notes, 4:457

Collection of many packages with easier interface than original implementation (Seungwoo Hwang, 24 November 2011)

I began trying out EMA package several months ago and found that EMA's re-manufactured function interfaces are indeed easier to use most of the time than those implemented in original packages. Highly recommended. read full comment

Comment on: Servant et al. BMC Research Notes, 3:277

National? (George Cowan, 08 November 2011)

A quick scan leads me to believe that this paper will be an important contribution in the US.

I was hoping that the data would be aggregated by nation. In this day and age, a title available on the internet or in a major research journal using the word "national" to indicate "stuff about my nation, whichever that may be", is misleading. Is it possible to change the word "National" to "US"? read full comment

Comment on: Muennig et al. BMC Research Notes, 4:385

Informative article (Hassan Soleimanpour, 07 November 2011)

I thank the author for good planning of implementation of her knowledge and experiance, completely compatible with technical guides in this issue.
Hassan Soleimanpour
Assistant professor of Anesthesiology,Emergency Medicine Department, Tabriz University of Medical Sciences read full comment

Comment on: Alizadeh-Asl BMC Research Notes, 4:16

SK-N-MC is EWS/PNET (Jo Vandesompele, 07 November 2011)

I would like to draw the attention to the fact that SK-N-MC, although originally described as a neuroblastoma cell line, is most likely derived from a EWS/PNET family tumor with a FLI1-EWS gene fusion resulting from a t(11;22) reciprocal translocation.

Dunn T, Praissman L, Hagag N, Viola MV. ERG gene is translocated in an Ewing’s sarcoma cell line. Cancer Genet Cytogenet 1994;76:19–22.

Vandesompele J, Speleman F. A brief commentary on "Chromosomal aberrations in neuroblastoma cell lines identified by cross species color banding and chromosome painting".
Comment on Cancer Genet Cytogenet. 2001 Aug;129(1):10-6.

read full comment

Comment on: Tavares et al. BMC Research Notes, 4:3

No visible scar surgery (Akira Miyajima, 10 October 2011)

Transumbilical approach enables us to do adrenalectomy without visible scar although this method requires "Cross Over Technique". I believe this approach is not too difficult for experienced surgeon. read full comment

Comment on: Miyajima et al. BMC Research Notes, 4:364

Coorection: Legend to Figure 1 (David Kateete, 10 October 2011)

In the original legend, Panel B incorrectly appears again for Panel D. The correct legend to figure 1 should read:

Figure 1, Representative images showing detection of virulence/antimicrobial resistance genes/determinants in MRSA isolates. Lanes: L, 100 bp DNA ladder; N, negative control (for all images). Panel A: 1 & 2, species confirmation of S. aureus by detection of the nuc gene; 3 & 4, ica; 5, bhp; 6 & 7, PVL. Panel B: 1 & 2, nuc; 3 & 4, tst1; 5 & 6, hla; 7 & 8, sdrE; 8, sea. Panel C: Detection of genes encoding aminoglycoside modifying enzymes (AMEs). 1 & 2, (aac(6’)-Ie-aph(2’’)-Ia); 3 & 4, (aph(3’)-IIIa); 5 & 6, (ant(4’)-Ia). Panel D. Graphical presentation of prevalence for selected determinants. read full comment

Comment on: Kateete et al. BMC Research Notes, 4:326

Hand dominance and satisfaction outcome measure (David Oliver Ferguson, 27 September 2011)

Dear sirs,

Please can you clarify the data you present in Table 3 and 4 regarding gender and dominance of arm. In table 3, you present a total of 51 patients who you classify as satisfied, but in table 4 there are only 20 patients satisfied. According to the rest of your article, there are 51 patients satisfied in other comparison groups.

I therefore believe your data on dominance is inaccurate. Furthermore, your conclusion that hand dominance has no influence on outcome satisfaction cannot be made. From my own observations in our regions fracture clinics, I have noticed that dominant arm sided diaphyseal clavicle fractures have a higher incidence of patient dissatisfaction.
read full comment

Comment on: De Giorgi et al. BMC Research Notes, 4:333

Correction: legend to Figure 1 (David Kateete, 27 September 2011)

Legend to Figure one should read: Neighbor joining dendrogram showing clustering among the genotyped MTB strains. The 15 clusters are indicated with a numerical red font. The order of MIRU loci is as follows, left to right: 424, 577, 580, 802, 960, 1644, 1955, 2163b, 2165, 2401, 2996, 3192, 3690, 4052 and 4156.
The last two MIRU loci (i.e., 4052 and 4156) were incorrectly labelled as 4952 and 4150, respectively. read full comment

Comment on: Nabyonga et al. BMC Research Notes, 4:280

Correction Table 1 (Takayoshi Terashita, 08 July 2011)

We apologize to the person who was interested in this article heartily.
We mistook the frequency about Place of interview, Combination measure for income, and Individual WTP in table 1.
Please refer to the following for these items:
Place of interview
Town’s hospital    14
Clinic          9
Participants’ office  7
Other          10

Combination measure for income
low           11
... read full comment

Comment on: Terashita et al. BMC Research Notes, 4:177

Erratum (Junko Ohyashiki, 29 March 2011)

The original version of this article unfortunately contained an error.
Th sentence in the discussion session (the first paragraph), "Second, the cell to plasma ratio was low in both AML and ALL" should be "Second, the cell to plasma ratio was high in both AML and ALL".
read full comment

Comment on: Ohyashiki et al. BMC Research Notes, 3:347

Cities as Cancer (Warren Martin Hern, 29 March 2011)

The provocative article by Ryan, et al [1] using a systems biology approach in comparing cancer metastasis with suburban sprawl development as a way of learning new strategies for understanding and treating cancer is an original and thought-provoking approach to a dread disease. The authors propose a hypothesis that making this comparison can be "instructive."
There are many kinds of cancer, and oncologists are always open to new ways of seeing and treating these illnesses.
The authors correctly point out that there are certain analogies between invasive suburban sprawl and cancer metastases, and they draw comparisons between the specific factors impelling uncontrolled urban growth and the biological markers (such as the loss of p53 function) that trigger malignant... read full comment

Comment on: Ryan et al. BMC Research Notes, 3:36