Skip to main content
Download PDF

Two proteocephalid cestodes in the fish Malapterurus electricus and Heterobranchus bidorsalis from Lake Nasser, Egypt: a morphological, molecular, and histopathological study

BMC Veterinary Research volume 20, Article number: 213 (2024) Cite this article

Abstract

Despite the importance of the electric catfish (Malapterurus electricus) and the African giant catfish (Heterobranchus bidorsalis) in the foodweb of Lake Nasser, Egypt, little is known about their diseases and parasitic fauna. This work describes, for the first time, cestodiasis in M. electricus and H. bidorsalis. Corallobothrium solidum and Proteocephalus sp. were identified morphologically and molecularly from M. electricus and H. bidorsalis, respectively. Using PCR, sequencing, and phylogenetic analysis, the two cestodes shared rRNA gene sequence similarities yet were unique and the two new sequences for the proteocephalid genera were submitted to the GenBank database. The prevalence of infection was 75% and 40% for the two fish species, respectively. Infections significantly increased in the summer and spring and were higher in female fish than in male fish. The intestine was the preferred site of the two adult cestodes. However, in the case of C. solidum some larval cestodes were found outside the intestine in between the skin and abdominal musculature, attached to the mesentery, and within intestinal tunica muscularis. Desquamation of the intestinal epithelium and inflammation at the site of infection in addition to congestion of the intestinal wall of the tapeworm infected fish were evident, indicating that C. solidum and Proteocephalus sp. impacted the infected fish. The larval stages of C. solidum attempted to penetrate the intestine and sometimes they were encircled within fibrous layers infiltrated with inflammatory cells. The infected fish’s musculature was free of cestode infections. Preventive measures should be implemented to prevent the spread of infections.

Peer Review reports

Introduction

There are approximately 461 species of cestodes that parasitise teleosts out of the known 4,810 species of cestodes that exist in the world [1]. Cestodes exhibit a high degree of host specificity and are common in all of Africa’s major water systems [2]. These are extremely effective parasitic infections in fish [3]. They mostly affect the gastrointestinal tract, particularly the intestine of vertebrates, and their larvae can be found in a variety of invertebrate and vertebrate body cavities as well as other organs [4]. Certain parasitic cestode infections harming fish are seen as an economic issue; they have an impact on fish weight gain, decreasing marketability, and occasionally, in severe cases, increasing mortality rates, leading to increased financial losses [5,6,7].

Proteocephalidea, which has six genera and nineteen species, is one of the most significant orders of cestodes [8]. Within the family Proteocephalidae, the genus Proteocephalus is a globally distributed parasitizing amphibians, reptiles, and fish [9, 10]. All Proteocephalus species have planktonic crustaceans, diaptomids, or cyclopid copepods as intermediate hosts, and vertebrates as final hosts, contracting the infection by ingesting them [11].

M. electricus and H. bidorsalis are among fish species found in Lake Nasser [12, 13]. Within the Malapteruridae family of electric catfishes, M. electricus is one of the most significant species currently known to exist in Africa [14, 15]. Its name comes from the electric organ that produces 300–400 Vs and forms a covering beneath the skin that surrounds the body. This covering is utilized as a defense mechanism and to catch prey [16]. Fresh or smoked M. electricus is highly prized by customers in Africa [17].

Furthermore, the Heterobranchus genus, which includes four significant species, including H. bidorsalis, is one of the most economically significant genera in the family Clariidae [14]. The African giant catfish, H. bidorsalis, is a very commercial species in African countries that performs better than other species in the family Clariidae [18]. With its ability to grow up to 1.2 m in length and 30 kg in weight, along with its ability to mature quickly in captivity (10–12 months), and it’s delicious and high-quality meat, this fish has a great deal of potential for aquaculture, particularly in Africa [19, 20].

The parasitic diseases that infect the fish in Lake Nasser are generally poorly understood [21,22,23]. This is especially true for the diseases of the two ecologically important fish species M. electricus and H. bidorsalis [24]. In order to better understand the cestodes causing the two types of catfish infections, this study will employ morphological, molecular, and phylogenetic analysis techniques to examine the cestodes. Clinical signs, postmortem lesions, organ or tissue susceptibility, prevalence, seasonal incidence, intensity, and histopathological changes will also be recorded.

Materials and methods

Study area

This study was conducted on two catfishes; M. electricus and H. bidorsalis from Lake Nasser. The lake is located in southern Egypt and is also known as the High Dam Lake. It was created after the construction of the High Dam across the Nile in Aswan between 1960 and 1970 (Fig. 1). The lake supports the fishing industry in Egypt and extends over 500 km; 350 km in Egypt and 150 km in Sudan. It has an average width of approximately 12 km at a water level of 180 m [25].

Fig. 1
figure 1

Location map of Lake Nasser, Aswan Governorate, Egypt

Full size image

Fish

During the period from May 2020 to April 2021, 300 fish specimens—200 M. electricus (47.5 ± 0.3 cm x 1650 ± 0.42 g) and 100 H. bidorsalis (60 ± 0.15 cm x 1628 ± 0.34 g)—were bought live from several fishermen on Lake Nasser. For each season, a quarter of the total fish were bought. The fish were transported to the Laboratory of Fish Health and Diseases at Aswan University’s Faculty of Fish and Fisheries Technology for parasitological examination.

Clinical signs and postmortem examination

Upon arriving the laboratory, the fish were euthanized a head blow immediately, followed by cervical dislocation according to the methods detailed by AVMA [26]. After that, total length of the fish measured (cm) and weighed (g), and their sex was determined as recorded by Eissa [27]. The external and internal gross lesions were recorded as defined by Eissa [27]. The infected fish were photographed.

Parasitological examination

Cestodes were observed with the naked eye or magnifying glass due to their large size, whitish color, or movements and collected. All internal organs, especially the intestine, intestinal wall, gall bladder, peritoneal cavity, and musculature, were examined to detect the cestodes or their detached proglottids. The recovered cestodes were cleaned and thoroughly rinsed in a saline solution to remove debris. They were then divided into two parts: some were preserved in alcohol-formalin-acetic acid until staining time, and some were kept in 70% ethyl alcohol at − 20 °C for molecular study. The preserved cestodes were stained with acetic acid alum carmine, dehydrated with ascending concentrations of ethyl alcohol, cleared in xylene, and finally mounted in Canada balsam according to Hamouda [6]. An Olympus DP74 camera attached to an Olympus BX43 microscope was used to examine and photograph the stained cestodes. Squash preparations of the musculature and internal organs were done by compressing small pieces of them between two glass slides and examining them under a stereomicroscope for the detection of cestode larvae. The number of recovered cestodes was counted per fish. The prevalence, mean intensity, and mean abundance of cestodal infections were recorded according to Bush et al. [28].

Identification of collected cestodes

C. solidum and Proteocephalus sp. were identified using taxonomic keys by Rego [9], Ibraheem [29], and Scholz et al. [30].

Molecular identification and phylogenetic analyses

Genomic DNA (gDNA) was extracted from each individual ethanol-preserved tapeworm using a phenol/chloroform technique as described by Younis et al. [31]. The parasite materials were, in short, precipitated with 5.2 M ammonium acetate after being digested with proteinase K in ALT buffer for a whole night at 56 °C (Dneasy Kit, Qiagen). The samples were diluted with 20–50 µL of ddH2O based on the size of the pellets. A Nanodrop spectrophotometer (Implen NP80, Germany) was used to determine the gDNA sample concentrations spectrophotometrically. Forward F2 (GTCGTAACAAGGTTTCCGTAGGTG) and reverse R2 (TATGCTTAAGTTCAGCGGGTAATC) primers were utilized to amplify the whole ITS region according to Brabec et al. [32]. A total of 50 µL of 1× thermal buffer (MyTaq Red Reaction buffer, Bioline, UK), 10–20 pmol forward and reverse primers, 10 mM dNTPs mix (Alliance Bio, USA), 5 u/µL Taq polymerase (Bioline, UK), and 0.1–0.2 µg gDNA were used in the PCR amplifications. In a thermocycler (Sensoquest Lab cycler, SensoQuest GmbH, Germany), the amplifications were carried out under the following cycling conditions: 5 min of initial denaturation at 95 °C, 30 s of 94 °C, 30 s of annealing at 55 °C, 30 s of elongation at 72 °C, and 2 min of final extension at 72 °C. As controls, samples with fish intestinal DNA or without gDNA were added to the PCR. On a 1% agarose gel, amplification products were examined and stained with ethidium bromide. Next, using ultraviolet (UV) gel documentation equipment (UVP Bio-Doc IT-220 Imaging System, BioExpress, USA), the DNA bands were immediately observed and photographed. The PCR products were purified using the DNA Clean and Concentrator Kit (Zymo Research, USA) in accordance with the manufacturer’s procedure. Using the same primers as in the original PCR, the refined products of PCR were sequenced in each direction (forward and reverse). An automated DNA sequencing machine (Model 3730XL) from Applied BioSystems (USA) and the dideoxy termination method (Macrogen Inc., Korea) were used. For each sequence, homology searches were performed using the NCBI Blast software (ncbi.nlm.nih.gov). After that, each forward sequence was manually altered and put together using the CAP3 algorithm after being compared to its reverse counterpart. Then, using the multiple sequence alignment tool CLUSTALW, the produced sequences were aligned to the most homologous sequences in the database as well as to each other. Phylogeny.fr, an online application, was used to construct phylogenetic trees. MUSCLE (v3.8.31) was used for alignment, and its default parameters were optimized for maximum accuracy. Gblocks (v0.91b) were used to eliminate unclear sections (those with gaps and/or misalignment) following alignment. The maximum likelihood technique (v3.1/3.0 aLRT) of the PhyML program was then used to reconstruct the phylogenetic tree. Lastly, the phylogenetic tree was edited and graphically represented using TreeDyn (v198.3) according to Dereeper et al. [33].

Histopathological examination

Parts of the infected intestines with C. solidum and Proteocephalus sp. of M. electricus and H. bidorsalis were preserved in 10% neutral buffered formalin. The samples were dehydrated in ascending concentrations of ethyl alcohol, embedded in paraffin wax, and then sectioned using a microtome to a thickness of 5 μm according to Suvarna et al. [34]. The sectioned samples were stained with hematoxylin and eosin, as described by Bancroft and Gamble [35].

Statistical analysis

The seasonal prevalence data were analyzed using one-way ANOVA tests followed by Duncan-test as a post-hoc (SPSS version 22, SPSS Inc., Il, USA). The level of significance was accepted at P < 0.05 According to Greenland et al. [36]. All data are presented as means ± standard error (SE).

Results

Clinical signs and postmortem examination

M. electricus and H. bidorsalis infected with C. solidum and Proteocephalus sp., respectively, exhibited no gross abnormalities, except that the heavily infected fish were emaciated and had distended abdomens.

The internal organs of infected M. electricus and H. bidorsalis were highly congested, particularly the infected intestines, Fig. (2) a, b, & Fig. (3) b, with increased mucus (3b).

M. electricus was infected with two forms of C. solidum (adult and larval stages) and to our knowledge; it is the first time to detect adult and larval stages of a particular cestode in the same host. Adult C. solidum was attached to the middle portion of the intestine but its larval stages were found outside the intestine in between the skin and abdominal musculature, Fig. (2) c, and attached to the mesentery of infected fish. While in H. bidorsalis, it was infected with adult Proteocephalus sp. that was exclusively attached to the middle portion of the intestine. Interestingly, there were no cestodes, either adult or larvae, in the musculature of the infected M. electricus and H. bidorsalis.

Recovered adult C. solidum and Proteocephalus sp. were white in color, reach up to 10 cm in length, highly active, and attained remarkable scoleces, Fig. (2) d & Fig. (3) b.

H. bidorsalis is characterized by the presence of a longer dorsal fin compared to its adipose fin and the absence of a black spot at its tail end, Fig. (3) a.

Fig. 2
figure 2

Malapterurus electricus infected with Corallobothrium solidum.a: Highly congested intestine (arrows) infected with large number of Corallobothrium solidum. b: Large number of Corallobothrium solidum (arrows) liberating from the congested intestine. c: Corallobothrium solidum (arrows) between the skin and abdominal musculature. d: Large number of Corallobothrium solidum recovered from the intestine of Malapterurus electricus

Full size image
Fig. 3
figure 3

Heterobranchus bidorsalis. a: Adipose fin (black arrow) and dorsal fin (black bordered white arrow). b: Congested intestine (black arrow) infected with Proteocephalus sp. (black bordered white arrow) with increased mucus secretion

Full size image

Parasitological examination

C. solidum and Proteocephalus sp. were prevalent all year in Lake Nasser; C. solidum was recorded in M. electricus, with a prevalence of 75% and infection intensities ranging from 1 to 50 cestodes per fish. Meanwhile, Proteocephalus sp. was recorded in H. bidorsalis with a prevalence of 40% and infection intensities ranging from 1 to 4 cestodes per fish. Table 1 showed the prevalence, intensity, and mean abundance of infections with C. solidum and Proteocephalus sp. in M. electricus and H. bidorsalis, respectively, from Lake Nasser in the period from May 2020 to April 2021.

Table 1 Prevalence, mean intensity and mean abundance of Corallobothrium solidum and Proteocephalus sp. in Malapterurus electricus and Heterobranchus bidorsalis respectively from Lake Nasser in the period from May 2020 to April 2021
Full size table

The female fish recorded higher infection rates than the male ones, as shown in Table 2.

Table 2 Rate of infections in male and female Malapterurus electricus and Heterobranchus bidorsalis infeted with Corallobothrium solidum and Proteocephalus sp. respectively from Lake Nasser in the period from May 2020 to April 2021
Full size table

C. solidum and Proteocephalus sp. recorded higher infection rates in the summer (90%, 60%), spring (80%, 40%), autumn (76%, 36%), and winter (54%, 12%) in a descending manner, as shown in Figs. 4 and 5. The recorded prevalence showed significant variations between summer and winter and between them and the other seasons (P < 0.05), while spring and autumn showed insignificant variations (P > 0.05).

Fig. 4
figure 4

Seasonal prevalence of Corallobothrium solidum in Malapterurus electricus from Lake Nasser in the period from May 2020 to April 2021. Bars with different letters are significantly different (P < 0.05). Values are expressed as mean ± SE. n = 200

Full size image
Fig. 5
figure 5

Seasonal prevalence of Proteocephalus sp. in Heterobranchus bidorsalis from Lake Nasser in the period from May 2020 to April 2021. Bars with different letters are significantly different (P < 0.05). Values are expressed as mean ± SE. n = 100

Full size image

Identification of collected cestodes

Only two cestodes were identified in this study from M. electricus and H. bidorsalis. Based on their morphological criteria, these two cestodes were C. solidum and Proteocephalus sp. respectively that belonged to Proteocephalidae because the testes, ovary, vitelline follicles, and uterus were medullary in position.

The cestode recovered from M. electricus was identified as C. solidum. Live C. solidum was white in color and reached up to ten centimeters long, Fig. (2) d. Scolex was large, umbrella shape with well-developed metascolex, much wider than the proliferative zone (neck). Metascolex was well-developed, formed a folded collar surrounding suckers. Suckers were large, uniloculate, and deeply embedded; the external (outer) margins of suckers had semispherical (U-shaped, i.e., interrupted anteriorly) musculature serving as a sphincter, Fig. (6) a, b, c. The larval cestode had a large apical organ that was spherical to oval in shape, and the metascolex was not fully developed, Fig. (6) d. Body surface with deep longitudinal and transverse grooves (wrinkles) forming a rectangular network (internal longitudinal musculature weakly developed, formed by a narrow band of isolated muscle fibers, more dense on the lateral sides of the strobili), Fig. (6) e. Testes were medullary, spherical to oval, in 2 irregular (incomplete) layers, in 2 lateral fields connected anteriorly. Cirrus-sac was oval and may be everted, Fig. (6) f. The ovary was medullary, compact, with small follicles on the surface, bilobed, and had short and wide lateral lobes connected by a ventrally situated isthmus. Vitelline follicles were medullary, small, and arranged in two narrow lateral bands. The uterus was a medullary uterine stem with numerous intensely staining cells concentrated along its wall in immature proglottids.

The cestode recovered from H. bidorsalis was identified as Proteocephalus sp.; live cestode was white in color and reach up to ten centimeters long, Fig. (3) b. The carmine-stained specimens do not show any characteristics because the cestode was highly contracted and very thick; only four suckers can be seen on the anterior end of the cestode. By histopathogical examinations, the testes, ovary, vitelline follicles, and uterus were seen medullary in position, Fig. (7) a, b.

Fig. 6
figure 6

Corallobothrium solidum isolated from Malapterurus electricus stained with acetic acid alum carmine. a: Scolex (black arrow) and strobila (white arrow), bar = 500 μm. b: Four suckers (arrows) in the scolex, bar = 200 μm. c: U- shape sucker (arrow) in the scolex, bar = 200 μm. d: Larval developmental stage showing apical organ (arrow), bar = 200 μm. e: Longitudinal and transverse grooves on the strobili, bar = 200 μm. f: Cirrus everted (arrows) from the strobili, bar = 200 μm

Full size image
Fig. 7
figure 7

Heterobranchus bidorsalis,s intestine. a: Proteocephalus sp. in the lumen (arrow), H&E, bar = 500 μm. Abbreviations: CT, cortex; LMB, longitudinal muscle bundle; MED, medulla; O, ovary; T, testes; U, uterus; VF, vitelline follicles. b. Proteocephalus sp. (black arrow) nearly blocks the intestinal lumen, and the red arrows indicate the intestinal wall, H&E, bar = 500 μm

Full size image

Molecular identification and phylogenetic analyses

Following morphological identification, C. solidum and Proteocephalus sp. identities were confirmed using specific primers. A part of the nuclear ribosomal RNA was amplified (the complete ITS region). The PCR products of both worms were ampilicons that were almost 1300 bp in length. For validation, the final sequences that were obtained were submitted to GenBank with the accession numbers MZ956915 and OR944060. They stand for the partial sequence (ITS1), complete sequence (5.8 S), and partial sequence (ITS2) for C. solidum and Proteocephalus sp., respectively. Both of the newly obtained sequences were unique from every other sequence in the GenBank databases, according to blast analysis. It is interesting to note that both sequences had a high similarity (95.77%) despite having median sequence coverage of 59%. The submitted sequence (MZ956915) of the ITS region is the first ITS sequence submission to the GenBank for the genus Corallobothrium. Only eight more sequences, ranging from 565 to 1034 bp, are available in GenBank. They include rRNA markers (28 S and 18 S) and COI but not a gene of the complete ITS region. The current limited phylogenetic tree lacks complete ITS sequences for additional potential sister taxa (the Corallobothriinae family) to Corallobothrium in the GenBank database, with the exception of one Megathylacus sequence that was found in a separate clade. Therefore, comparing the current sequence to other sequences belonging to the same genus or subfamily was not possible. The current ITS sequence of C. solidum, however, exhibited similarities to other ITS sequences of several members belonging to the order Proteocephalidea. On the other hand, the present ITS sequence of Proteocephalus sp. showed similarities to other sequences of other Proteocephalids. For example, it has similarities (80.59%, 93.39%, and 96.17%) to other ITS sequences (AB558485, MN787161, and AY551170) of P. ambloplitis, P. tetrastomus, and P. pirarara respectively. The most relevant 46 nucleotide sequences, including the present two, were used in the present limited phylogenetic analyses, Fig. (8). It appears that the two present sequences emerged in the same clade as the sequences of Amphoteromorphus parkamoo (acc. no. AY551139) and A. piraeeba (acc. no. AY551140). The constructed phylogram revealed that the worms examined in this study showed a very close phylogenetic relationship, with branches mostly mixed with most species. They were found to be embedded within the order Procephalidea, with considerable divergence, Fig. (8).

Fig. 8
figure 8

A phylogenetic tree was constructed using the Phylogeny.fr program (http://www.phylogeny.fr/) utilizing the most related and aligned complete ITS sequences of Corallobothrium solidum and Proteocephalus sp., including those identified in this study (*).The branches displayed the Bootstrap support values. The compared sequences were denoted by accession numbers, and names

Full size image

Histopathological examination

The deleterious effects of C. solidum and Proteocephalus sp. on the intestines of infected fish species have been documented. The intestine of M. electricus infected with C. solidum revealed the presence of C. solidum attached to the intestinal wall and the larval stages attempted to penetrate the intestinal wall and sometimes they were encircled within fibrous layers infiltrated with inflammatory cells and congestion within the intestinal tissues was evident, in addition to, some larval stages were enclosed by the serosal membrane outside the intestine, Fig. (9) a, b, c, d, Fig. (10) a, b, c, d, Fig. (11) a, c, d. The infected intestine revealed necrosis and distortion of the tunica muscularis, hemorrhages, and marked inflammatory cell infiltrations, including eosinophilic granular cells within the intestinal wall, Fig. (9) a, b, c, d, Fig. (10) a, b, & Fig. (11) c, d, as well as sloughing the epithelial lining of the infected intestine at sites of cestodes attachments, Fig. (9) a, d, Fig. (10) d, & Fig. (11) (a) Section of C. solidum appeared as leaf-like cestode of multi-villous cuticle with inner gonadal tissues, Fig. (11) (b) Some larval stages of C. solidum encysted in the intestinal wall are encircled with a fibrous layer and inflammatory cell infiltration, Fig. (10) b, & Fig. (11) c, d. Proteocephalus sp. attached to the intestinal wall of H. bidorsalis may block the intestinal lumen, Fig. (7) b.

Fig. 9
figure 9

The intestine of Malapterurus electricus. a: Corallobothrium solidum inside the intestinal lumen (black arrow), within the intestinal wall (star) and enclosed in a sheath outside intestinal wall (black bordered white arrow). Erosions in the intestinal epithelium (red arrow) and congestion (H letters), H&E, bar = 500 μm. b: Corallobothrium solidum inside the intestinal lumen (red arrow), within the intestinal wall (black arrow) and enclosed in a sheath outside intestinal wall (green arrows), congestion (H letters), H&E, bar = 500 μm. c: Corallobothrium solidum within the intestinal wall (black arrow) and enclosed in a sheath outside intestinal wall (green arrow). Hemorrhages (H letters), H&E, bar = 200 μm. S: sucker. d: Corallobothrium solidum inside the intestinal lumen (black arrows), within the intestinal wall (star), the cestode attaching the intestinal epithelium (red arrow), congestion (H letters), H&E, bar = 500 μm

Full size image
Fig. 10
figure 10

Malapterurus electricus,s intestine. a: Scolex of Corallobothrium solidum within the intestinal wall (black arrow) showing 3 suckers, congestion (H letters), H&E, bar = 200 μm. b: Intestinal section of Corallobothrium solidum showing encysted cestode parasite with apparent apical sucker (arrow) encircled with fibrous layer and mild inflammatory cells infiltration (arrowheads), H&E, X40, bar = 400 μm. c: Scolex of Corallobothrium solidum within the intestinal serosa outside the intestine showing 4 suckers (black arrow), H&E, bar = 500 μm. d: Scolex of Corallobothrium solidum in the intestinal lumen (black arrow) showing 2 suckers and erosions of the intestinal epithelium at site of attachment (black bordered white arrows), H&E, bar = 200 μm. S: suckers

Full size image
Fig. 11
figure 11

Malapterurus electricus,s intestine. a: Intestinal plug fromed by large Corallobothrium solidum of three fold-like structures (black bordered white arrow), the cestode engluf the epithelial lining of the intestine (black arrow), errosions of intestinal epithelium (stars), hemorrhages (H letters), H&E, bar = 500 μm. b: Section of Corallobothrium solidum showing leaf-like cestode of multi-villous cuticle (arrowheads) with inner gonadal tissues (arrow), H&E, X40, bar = 200 μm. c: Encysted Corallobothrium solidum with three apparent sukers with apical basophilic suckers (arrowheads) and associated with necrosis and distortion of the muscle tissues, congestion (H letter) and marked inflammatory cells infiltration (arrow), H&E, X40, bar = 400 μm. d: Encysted Corallobothrium solidum (arrowheads) associated with necrosis and distortion of the muscle tissues, hemorrhages and marked inflammatory cells infiltration including eosinophilic granular cells (arrow), H&E, X40, bar = 400 μm

Full size image

Discussion

Numerous studies on parasitic diseases in fish in Lake Nasser have been carried out, but little is recorded on M. electricus and H. bidorsalis [18, 37, 38].

The cestodes of the genus Proteocephalus are distributed worldwide infecting a wide range of hosts, including fish, and due to the wide variation in morphological characteristics in Proteocephalus spp. we integrated ITS sequence and phylogenetic analysis into the observed morphological criteria of C. solidum and Proteocephalus in this study [39,40,41].

In addition to the adult C. solidum in the mid portion the intestinal tract of M. electricus, larval C. solidum (plerocercoid) were found in the coelomic cavity and underneath the skin, suggesting that M. electricus serves as both final and intermediate host for the same proteocephalid. This characteristic is differed from those reported by other researchers who recorded C. solidum only from the intestine of infected M. electricus [29, 30, 42]. Proteocephalus sp. was isolated exclusively from the mid portion of the intestinal tract of H. bidorsalis.

There was clear difference in the worms, tegument thickness between C. solidum and Proteocephalus sp. with Proteocephalus sp. tegument approximately ten times thicker than C. solidum. Such obvious variation in the thickness may be due to variation in the pH and nature of digestive enzymes in both fish species. It is well documented that proteocephalid cestodes are protected from the intestinal proteolytic enzymes by producing proteinase inhibitors. For example, Eubothrium rugosum secretes proteinase inhibitor that inactivates the digestive enzymes of its host burbot (Lota lota) [43]. Similar finding were reported by Izvekova et al. [44] on several mechanisms performed by cestodes to protect its tegument from the powerful digestive enzymes. Whether or not the increased thickness of the Proteocephalus sp. found in the African giant catfish is a protective mechanism to the prevailing condition in the host intestine remains to be studied.

In this study, the suckers of C. solidum and Proteocephalus sp. cling firmly to the intestinal mucosa inducing increased mucus secretion and congestion around the site of attachment beside the larval stages of C. solidum even penetrate the intestinal wall, resulting in inflamed and congested intestine [6]. Increased mucus secretion in the intestine of infected fish as a defense mechanism of the fish host immune system is consistent with Hamouda [6], Bosi et al. [45] and Bosi et al. [46] who declared that intestinal helminths influence intestinal mucus secretion.

Considering this firm attachment of multiple large-size cestodes, the intestinal function of the host is definitely compromised. The harm is further amplified in some individual fish whose intestine were completely occluded affecting the food passage, reducing absorption, destructing intestinal wall and leading to the emaciation that appeared on some individual fish [39, 47]. In the same context, the cestodes have no digestive tract and took their required nutrients through the absorption of host food by their outer surface microtriches [48, 49].

The recovered cestodes were large in size and could be seen easily by naked eyes, making consumers reject the infected fish in spite of the fact that the recovered C. solidum and Proteocephalus sp. did not have zoonotic potential, resulting in economic losses.

Fortunately, the edible musculature of the infected fish was free from cestodes even in heavily infected fish.

Ibraheem [29] and Osman et al. [42] studied M. electricus in Egypt and discovered two species of cestodes that were highly specific to it: C. solidum and Electrotaenia malepteruri, but in this study, C. solidum was the only cestode recovered from this fish species in the lake. This could be due to the variety of study regions, as well as the environmental abiotic and biotic variables encountered during these studies. However, C. solidum plerocercoid was never reported outside the gastrointestinal tract before and these previous studies lacked molecular confirmation.

The collected C. solidum and Proteocephalus sp. of this study were morphologically similar to those recorded by Rego [9], Ibraheem [29] and Scholz et al. [30]. These studies [9, 29, 30] lacked epidemiological data about the prevalence of C. solidum and Proteocephalus sp. in M. electricus and H. bidorsalis collected from the Nile downstream from Lake Nasser, however in our study C. solidum and Proteocephalus sp. were present year-round indicating the abundance of the intermediate hosts such as cyclopid copepods, planktonic crustaceans, freshwater shrimps, and many others that harbor metacestodes [11, 12].

The females showed a higher prevalence of infection than males, and this could be a result of the random samples of collected fish, and the female fish may be more active in feeding than males, especially during spawning, to meet higher energy resources [17, 50].

The higher prevalence of infection in summer and spring seasons may be a result of suitable optimal water temperatures during these seasons, which favor the multiplication of intermediate hosts and increase fish feeding activities that facilitate parasitic transmission [42].

To our knowledge, this study is the first report of C. solidum and Proteocephalus sp. from M. electricus and H. bidorsalis, respectively, in Lake Nasser and constitutes a new geographic locale. It seems that the infection of M. electricus with C. solidum was not present in the lake, at least till 1983 [37] however, in 1984 Saoud and Wannas [38] examined 50 M. electricus and recorded 96% cestode infection yet these cestodes were never identified. In addition to, there is no data on H. bidorsalis cestode infections from Lake Nasser. Therefore there are no data to use for comparison.

In this study, C. solidum was recorded from M. electricus with a prevalence of 75% and infection intensities ranging from 1 to 50 cestodes per fish, which was different from that recorded by Ibraheem [29], who recorded it from the same fish in El-Minia Province, Egypt, with a prevalence of 50% and infection intensities ranging from 1 to 7 cestodes per fish. The difference in prevalence and intensities may be related to the changes in environmental abiotic and biotic conditions during these studies.

Molecular biology techniques such as polymerase chain reaction (PCR) and sequencing of several molecular markers are powerful tools for identifying cestode parasites and confirming their taxonomic and systematic status, as well as generic phylogenetic relationships [18, 51].

The current molecular study revealed that C. solidum and Proteocephalus sp. ITS sequences were unique yet shares some similarities to other Proteocephalidean sequences in the GenBank database. The phylogenetic analyses performed in this work allocated the most studied cestodes, which appeared scattered, to hybridized branches, with the exception of Megathylacus’ sequence, which is currently in a different clade. The lack of complete ITS sequences for cestodes in the GenBank database may reflect the absence of other potential sister taxa within the Corallobothriinae family to Corallobothrium in the phylogenetic tree of this study. Interestingly, previous phylogenetic analyses of partial sequences of the 28 S rRNA gene showed that Corallobothrium was not monophyletic [30]. Furthermore, according to molecular data, the subfamily with Megathylacus can be polyphyletic [52, 53]. The sequences of Amphoteromorphus parkamoo (acc. no. AY551139) and A. piraeeba (acc. no. AY551140), which are members of Proteocephalidea: Zygobothriinae [52], and the two current sequences all emerged in the same clade. Given the relative lengths of the branches in the phylogenetic diagram and the nodal support between them, it is probable that the order (Proteocephalidea) contains significant genetic variety. This indicates that molecular diagnosis and phylogenetic relationships are challenging, most likely because of the presence of cryptic species. These findings were consistent with the findings of Scholz et al. [30], De Chambrier et al. [51], Zygobothriinae [52], Hypsa et al. [53], Zehnder & Mariaux [54] and Waeschenbach & Littlewood [55].

The detected tapeworms had serious pathological effects on their hosts, especially the intestine, which showed degenerative changes in the intestinal mucosa with desquamation of the intestinal epithelium and enteritis. This was consistent with Hamouda [6], who recorded the same similar lesions from Clarias gariepinus infected with different cestodes Polyonchobothrium clarias, and Monobothrioides. The sloughing of the epithelial lining of the infected intestine at sites of cestodes attachment may be a result of the suckers’ attachments to the intestinal epithelium [29, 47].

M. electricus infected with C. solidum in the intestinal lumen, tunica muscularis, and enclosed by the serosal membrane covered the intestine. The infected intestine showed necrosis and distortion of the tunica muscularis, hemorrhages, and marked inflammatory cell infiltrations, including esinophilic granular cells within the intestinal wall, in which the larval stages of C. solidum penetrates more deeply, reaching the muscle layer and inducing destruction of the intestinal architecture due to intense inflammatory response. This was different from that recorded by Ibraheem [29], who recorded it only from the intestinal lumen, and in his histopathological study, he did not record any attack of C. solidum via the intestinal wall. The severity of the pathological lesions reported in M. electricus was much greater than that seen in H. bidorsalis, and this could be due to the fact that Proteocephalus sp. of H. bidorsalis did not invade the intestinal wall later and did not attach firmly to the intestinal wall.

This paper reported severe, drastic intestinal lesions associated with the two species of proteocephalid cestodes (C. solidum and Proteocephalus sp.) within the intestinal tract of the two catfish, especially M. electricus. Our results of severe and extensive intestinal lesions starting from the mucosa, submucosa, and tunica muscularis and ending with serosa suggest that these intestinal cestodiasis may be accompanied by disturbances in digestion and/or absorption, competition for nutrients with the host, and physiological stressor to the host due to enteritis, leading to great economic losses.

Conclusions

This study is the first report of C. solidum and Proteocephalus sp. from M. electricus and H. bidorsalis, respectively, in Lake Nasser and constitutes a new geographic locale. They are first identified both morphologically and molecularly. The detected C. solidum and Proteocephalus sp. have serious pathological effects on their hosts, especially the intestine. Adult C. solidum was found in the intestine of M. electricus but its plerocercoid were found in the coelomic cavity and underneath the skin, suggesting that M. electricus serves as both final and intermediate host for the same proteocephalid. Proteocephalus sp. infect H. bidorsalis was exclusively found in the intestine. The edible musculature of the infected M. electricus and H. bidorsalis was free from cestodes even in heavily infected fish. Prevent the transfer of cestode-infected fish to a new region before treatment. Current molecular and phylogenetic analyses confirm that proteocephalid taxonomy and systematics pose ongoing issues for taxonomic classification, requiring further molecular and phylogenetic analyses for the separation of closely related genera and species as well as generic phylogenetic relationships.

Data availability

The data sets used in the present study are accessible on reasonable request from the corresponding author.

References

  1. Caira JN, Jensen K. Planetary Biodiversity Inventory (2008–2017): Tapeworms from Vertebrate Bowels of the Earth. University of Kansas, Natural History Museum, Special Publication No 25: 2017;1–463.

  2. Abowei JFN, Ezekiel EN. Trematoda, tape worms: infections by larval and other tape worms; and nematoda in African fish (a review). Int J Anim Veterinary Adv. 2011;3(5):352–66.

    Google Scholar 

  3. Zhou X, Tian Y, Liu L, Ge L, Zhang H, Liang Y et al. Pathologic, transcriptomic and microbiomic insight into the pathogenesis of intestinal parasitic tapeworm in cultured Chinese soft-shelled turtle (Pelodiscus sinensis), aquaculture, 2023;562:738788. https://doi.org/10.1016/j.aquaculture.2022.738788.

  4. Scholz T, Kuchta R, Oros M. Tapeworms as pathogens of fish: a review. J Fish Dis. 2021;44(12):1883–900. https://doi.org/10.1111/jfd.13526.

    Article  PubMed  Google Scholar 

  5. Noga EJ. (2010). Fish diseases (Diagnosis and Treatment) (2nd Ed.). Wiley-Blackwell. https://www.wiley.com/en-us/Fish+Disease%3A+Diagnosis+and+Treatment%2C+2nd+Edition-p-9780813806976.

  6. Hamouda AH. Studies on the trematodal and cestodal diseases in cultured freshwater fish in Kafr El-Sheikh Governorate. PhD thesis, Egypt: Faculty of Veterinary Medicine, Kafrelsheikh University. 2014.

  7. Santos MA, Jerônimo GT, Cardoso L, Tancredo KR, Medeiros PB, Ferrarezi JV, et al. Parasitic fauna and histopathology of farmed freshwater ornamental fish in Brazil. Aquaculture. 2017;470:103–9. https://doi.org/10.1016/j.aquac.

    Article  Google Scholar 

  8. Kuchta R, Burianová A, Jirků M, Chambrier A, Oros M, Brabec J, et al. Bothriocephalidean tapeworms (Cestoda) of freshwater fish in Africa, including erection of Kirstenella n. gen. and description of Tetracampos martinae n. Sp. Zootaxa. 2012;3309:1–35. https://doi.org/10.11646/zootaxa.3309.1.1.

    Article  Google Scholar 

  9. Rego AA. Order Proteocephalidea Mola, 1928. pp. 257–293 in Khalil LF, Jones A, Bray RA, editors Keys to the cestode parasites of vertebrates. Wallingford, Oxon, CAB Intemationa, UK. 1994.

  10. Abdel-Gaber R, Alajmia R, Al Quraishya S, Morsyb K, Al Rasheida K. Characterization of 28S rRNA sequences of cestoda parasite Electrotaenia malapteruri Fritsch, 1886 from the Electric catfish Malapterurus electricus (Siluriformes: Malapteruridae). Acta Trop. 2018;183:153–61. https://doi.org/10.1016/j.actatropica.2018.04.016.

    Article  CAS  PubMed  Google Scholar 

  11. Scholz T. Life cycles of species of Proteocephalus, parasites of fishes in the Palearctic Region: a review. J Helminthol. 1999;73(1):1–19. https://doi.org/10.1017/S0022149X99000013.

    Article  CAS  PubMed  Google Scholar 

  12. Bishai HM, Abdel-Malek SA, Khalil MT. Lake Nasser A treatise, Publication of National Biodiversity Unit. No.11.2000. Arab Republic of Egypt Cabinet of Ministers. Egyptian Environmental Affairs Agency (EEAA), Department of Nature Protection; 2000.

  13. Halls AS, Habib OA, Nasr-Allah A, Dickson M. Lake Nasser fisheries: Literature review and situation analysis. WorldFish. Program Report: 2015;2015–42. https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/463/3921_2015-42.pdf?sequence1=.

  14. Teugels GG. Taxonomy, phylogeny and biogeography of catfishes (Ostariophysi, Siluroidei): an overview. Aquat Living Resour. 1996;9:9–34.

    Article  Google Scholar 

  15. Ferraris CJ. Checklist of catfishes, recent and fossil (Osteichthyes: Siluriformes), and catalogue of siluriform primary types. Zootaxa, 2007;1418:1–628, Magnolia Press, New Zealand. https://www.mapress.com/zootaxa/2007f/zt01418p300.pdf.

  16. Omeji S, Tiamiyu LO, Annune PA, Solomon SG. Ecto and intestinal parasites of Malapterurus electricus from upper river Benue. J Global Biosci. 2014;3(6):895–903. https://www.mutagens.co.in/jgb/03/6/04.pdf.

    Google Scholar 

  17. Kuton MP, Ayanda IO, Uzoalu IA, Akhiromen DI, George A, Akinsanya B. (2021). Studies on heavy metals and fish health indicators in Malapterurus electricus from Lekki Lagoon, Lagos, Nigeria. Veterinary and Animal Science, 12 (2021), 100169. https://doi.org/10.1016/j.vas.2021.100169.

  18. Hamouda AH, Younis AE. Molecular characterization of zoonotic anisakid Contracaecum spp. larvae in some fish species from Lake Nasser. Egypt Aquaculture Res. 2022;53:2548–61. https://doi.org/10.1111/are.15774.

    Article  CAS  Google Scholar 

  19. Adebayo OT, Fagbenro OA. Induced ovulation and spawning of pond raised African giant catfish, Heterobranchus bidorsalis by exogenous hormones. Aquaculture. 2004;242:229–36. https://doi.org/10.1016/j.aquaculture.2004.07.019.

    Article  CAS  Google Scholar 

  20. Olaniyi WA, Omitogun OG. Embryonic and larval developmental stages of African giant catfish Heterobranchus bidorsalis (Geoffroy Saint Hilaire, 1809) (Teleostei, Clariidae). SpringerPlus, 2014;3:677. https://doi.org/10.1186/2193-1801-3-677.

  21. Hamouda AH, Sorour SS, El-Habashi NM, El-Hussein AA. Parasitic infection with emphasis on Tylodelphys spp. as new host and locality records in Nile perch; Lates niloticus from Lake Nasser. Egypt World’s Veterinary J. 2018;8:19–33. https://eprints.science-line.com/id/eprint/445/1/WVJ%208%281%29%2019-33%2C%20Mar%2025%2C%202018.pdf.

    Google Scholar 

  22. Hamouda AH. Parasitic infections and histopathological changes in the squeaker fishes, Synodontis serratus and Synodontis schall from Lake Nasser. Egypt Assiut Veterinary Med J. 2019;65(161):208–24. https://doi.org/10.21608/avmj.2019.168905.

    Article  Google Scholar 

  23. Sorour SS, Hamouda AH. Prevalence of nematodes infestation in Clarias gariepinus from El-Burullus Lake and Lake Nasser, Egypt. Iraqi J Veterinary Sci. 2019;33(2):181–8. https://doi.org/10.33899/IJVS.2019.162963.

    Article  Google Scholar 

  24. Scholz T, Kuchta R. A digest of fish tapeworms. Vie et Milieu-Life Environ. 2017;67(2):43–58.

    Google Scholar 

  25. El Gammal EA, Salem SM, El Gammal AA. Change detection studies on the world’s biggest artificial lake (Lake Nasser, Egypt). Egypt J Remote Sens Space Sci (2010). 2010;13:89–99. https://doi.org/10.1016/j.ejrs.2010.08.001.

    Article  Google Scholar 

  26. AVMA (American Veterinary Medical Association). (2020). Guidelines for the Euthanasia of Animals: 2020 Edition, 1931 N. Meacham Road, Schaumburg, IL 60173, USA. https://www.avma.org/sites/default/files/ 2020- 01/ 2020_ Eutha nasia_ Final_1-15-20. Pdf.

  27. Eissa AE. (2016). Clinical and laboratory manual of fish diseases. LAP LAMBERT Academic Publishing. https://www.morebooks.shop/store/gb/book/clinical-and-laboratory-manual-of-fish-diseases/isbn/978-3-659–87612–7.

  28. Bush AO, Lafferty KD, Lotz JM, Shostak AW. (1997). Parasitology meets ecology on its own terms: Margolis revisited. The Journal of Parasitology 83(4), 575–583. https://doi.org/10.2307/32842.

  29. Ibraheem MH. The mode of attachment of two cestode species infesting the Nile electric catfish Malapterurus electricus (Froskal), with species reference to the functional morphology of the scolex and histopathology. Arab Gulf J Sci Res. 1998;16:159–72.

    Google Scholar 

  30. Scholz T, De Chambrier A, Mariaux J, Kuchta R. Redescription of Corallobothrium solidum (Cestoda: Proteocephalidea) and erection of a new genus, Essexiella, for tapeworms from channel catfishes (Ictaluridae). J Parasitol. 2011;97(6):1142–51. https://doi.org/10.1645/GE-2705.1.

    Article  PubMed  Google Scholar 

  31. Younis AE, Saad AI, El-Akhal IRM, Saleh NMK. A parasitological survey of zoonotic cestodes carried by house rats in Aswan, Egypt, reveals cryptic diversity at the molecular level. Veterinary World. 2021;14(8):2160–9. https://doi.org/10.14202/vetworld.2021.2160-2169.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Brabec J, Kuchta R, Scholz T. Paraphyly of the Pseudophyllidea (Platyhelminthes: Cestoda): circumscription of monophyletic clades based on phylogenetic analysis of ribosomal RNA. Int J Parasitol. 2006;36:1535–41. https://doi.org/10.1016/j.ijpara.2006.08.003.

    Article  CAS  PubMed  Google Scholar 

  33. Dereeper A, Audic S, Claverie JM, Blanc G. BLAST-EXPLORER helps you building datasets for phylogenetic analysis. BMC Evol Biol. 2010;10:8. https://doi.org/10.1186/1471-2148-10-8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Suvarna SK, Layton C, Bancroft JD. Bancroft’s theory and practice of histological techniques. London: Eighth Edition, Elsevier Limited; 2019.

    Google Scholar 

  35. Bancroft JD, Gamble M. Theory and practice of histological techniques. 6th ed. London: Churchill Livingstone; 2007. pp. 121–34.

    Google Scholar 

  36. Greenland S, Senn SJ, Rothman KJ, Carlin JB, Poole C, Goodman SN, Altman DG. Statistical tests, P values, confidence intervals, and power: a guide to misinterpretations. Eur J Epidemiol. 2016;31(4):337–50. https://doi.org/10.1007/s10654-016-0149-3.

    Article  PubMed  PubMed Central  Google Scholar 

  37. El-Naffar MK, Saoud ME, Hassan IM. A general survey of helminth parasites of some fish from Lake Nasser at Aswan, Egypt. Assiut Veterinary Med J. 1983;11(2):141–8.

    Google Scholar 

  38. Saoud MF, Wannas MQ. (1984). A qualitative and quantitative survey on the helminth parasites of fishes from the Aswan High Dam Lake in Egypt. Qatar University science bulletin. (1984) 4, 129–142.

  39. Dick TA, Chambers C, Isinguzo I. (2006). Cestoidea (Phylum Platyhelminthes) in P T K Woo (2nd edition), Fish Diseases and Disorders, Volume 1: Protozoan and Metazoan Infections Second Edition (pp. 391–416), CAB International UK. https://doi.org/10.1079/9780851990156.0000.

  40. Anikieva LV, Ieshko EP, Lebedeva DI. Morphological variability of Proteocephalus percae (Müller 1780) parasitizing coregonid fishes. Parazitologiya. 2015;49(3):160–70.

    CAS  Google Scholar 

  41. Hamouda AH, Younis AE. Characterization of Clinostomum Cutaneum and Clinostomum phalacrocoracis in tilapia species of Aswan Governorate, Egypt: a morphological, molecular and histopathological study. Aquac Res. 2021;52:6726–40. https://doi.org/10.1111/are.15543.

    Article  CAS  Google Scholar 

  42. Osman GY, Radwan NA, Khalil AI, Abo Msalam AM. Helminth communities of Bagrus Docmac and Malepterurus electricus in three water bodies at Menoufiya Governorate, Egypt. Egypt J Experimental Biology (Zool). 2008;4:177–92.

    Google Scholar 

  43. Izvekova GI, Frolova TV, Izvekov EI. Inactivation of proteolytic enzymes by Eubothrium rugosum (Cestoda) from the gut of burbot Lota lota. Folia Parasitol. 2017;64:1–8. https://doi.org/10.14411/fp.2017.016.

    Article  CAS  Google Scholar 

  44. Izvekova GI, Frolova TV, Izvekov EI, Zhokhov AE. Surviving in the fish gut: comparative inhibitory capacities against the host proteinases in cestodes of the genus Proteocephalus. J Fish Dis. 2022;45:1011–21. https://doi.org/10.1111/jfd.13624.

    Article  CAS  PubMed  Google Scholar 

  45. Bosi G, Shinn AP, Giari L, Dezfuli BS. Enteric neuromodulators and mucus discharge in a fish infected with the intestinal helminth Pomphorhynchus laevis. Parasites Vectors. 2015;8:359. https://doi.org/10.1186/s1307.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  46. Bosi G, Giari L, DePasquale JA, Carosi A, Lorenzoni M, Dezfuli BS. Protective responses of intestinal mucous cells in a range of fish–helminth systems. J Fish Dis. 2017;40:1001–14. https://doi.org/10.1111/jfd.12576.

    Article  CAS  PubMed  Google Scholar 

  47. Shostak AW, Dick TA. Intestinal pathology in northern pike, Esox lucius L., infected with Triaenophorus crassus Forel, 1868 (Cestoda: Pseudophyllidea). J Fish Dis. 1986;9:35–45. https://doi.org/10.1111/j.1365-2761.1986.tb00977.x.

    Article  Google Scholar 

  48. Bruno DW, Nowak B, Elliott DG. (2006). Guide to the identification of fish protozoan and metazoan parasites in stained tissue sections. Diseases of Aquatic Organsims 12, 70 (1–2), 1–36. https://doi.org/10.3354/dao070001. PMID: 16875388.

  49. Chervy L. Unified terminology for cestode microtriches: a proposal from the International Workshops on Cestode Systematics in 2002–2008. Folia Parasitol. 2009;56(3):199–230. https://doi.org/10.14411/fp.2009.025.

    Article  Google Scholar 

  50. Ayanda OI. Comparison of parasitic helminth infection between the sexes of Clarias gariepinus from Asa dam, Ilorin, North-Central Nigeria. Sci Res Essays. 2009;4(4):357–60.

    Google Scholar 

  51. De Chambrier A, Waeschenbach A, Fisseha M, Scholz T, Mariaux J. A large 28S rDNA-based phylogeny confirms the limitations of established morphological characters for classification of proteocephalidean tapeworms (Platyhelminthes, Cestoda). ZooKeys. 2015;500:25–59. https://doi.org/10.3897/zookeys.500.9360.

    Article  Google Scholar 

  52. De Chambrier A, Scholz T, Beletew M, Mariaux J. A new genus and species of Proteocephalidean (cestoda) from Clarias catfishes (Siluriformes: Clariidae) in Africa. J Parasitol. 2009;95(1):160–8.

    Article  PubMed  Google Scholar 

  53. Hypsa V, Skeríkova A, Scholz T. Phylogeny, evolution and host-parasite relationships of the order Proteocephalidea (Eucestoda) as revealed by combined analysis and secondary structure characters. Parasitology. 2005;130(Pt 3):359–71. https://doi.org/10.1017/s0031182004006638.

    Article  CAS  PubMed  Google Scholar 

  54. Zehnder MP, Mariaux J. Molecular systematic analysis of the order Proteocephalidea (Eucestoda) based on mitochondrial and nuclear rDNA sequences. Int J Parasitol. 1999;29(11):1841–52. https://doi.org/10.1016/S0020-7519(99)00122-8.

    Article  CAS  PubMed  Google Scholar 

  55. Waeschenbach A, Littlewood DTJ. (2017). A molecular framework for the Cestoda. In Planetary Biodiversity Inventory (2008–2017): Tapeworms from Vertebrate Bowels of the Earth. Caira JN and Jensen K, editors. University of Kansas, Natural History Museum, Special Publication No. 25, Lawrence, KS, USA, pp. 431–451.

Download references

Acknowledgements

The authors wish to express their gratitude and sincere thanks to Prof. Mohamed Faisal, Department of Pathobiology and Diagnostic Investigation, College of Veterinary Medicine, Michigan State University, USA, for reviewing and editing the final manuscript’s English language.

Funding

No fund.

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Author information

Authors and Affiliations

  1. Fish Health and Diseases Department, Faculty of Fish and Fisheries Technology, Aswan University, Aswan, 81528, Egypt

    Awatef Hamed Hamouda

  2. Zoology Department, Faculty of Science, Aswan University, Aswan, 81528, Egypt

    Abuelhassan Elshazly Younis

Authors
  1. Awatef Hamed Hamouda
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Abuelhassan Elshazly Younis
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

The two authors contributed equally to this work, whereas they designed and conducted the research, and wrote the manuscript. AHH worked the research, done the statistical analysis, and wrote the manuscript, AEY done the genetic analysis and revised the manuscript.

Corresponding author

Correspondence to Awatef Hamed Hamouda.

Ethics declarations

Ethical approval

This study was approved by Aswan University’s Animal Use and Care Committee, Faculty of Fish and Fisheries Technology, Egypt (Protocol No. 10/2020).

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Guidelines

All methods were carried out in accordance with relevant guidelines and regulations.

Arrive guidelines

The authors confirm that the study was carried out in compliance with the ARRIVE guidelines.

Conflict of interest

The authors declare no potential conflicts of interests with respect to the research, authorship, and/or publication of this article.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Hamouda, A.H., Younis, A.E. Two proteocephalid cestodes in the fish Malapterurus electricus and Heterobranchus bidorsalis from Lake Nasser, Egypt: a morphological, molecular, and histopathological study. BMC Vet Res 20, 213 (2024). https://doi.org/10.1186/s12917-024-04048-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12917-024-04048-1

Keywords

BMC Veterinary Research

ISSN: 1746-6148

Contact us