- Research article
- Open access
- Published:
Expression of the neuroprotective slow Wallerian degeneration (WldS) gene in non-neuronal tissues
BMC Neuroscience volume 10, Article number: 148 (2009)
Abstract
Background
The slow Wallerian Degeneration (WldS) gene specifically protects axonal and synaptic compartments of neurons from a wide variety of degeneration-inducing stimuli, including; traumatic injury, Parkinson's disease, demyelinating neuropathies, some forms of motor neuron disease and global cerebral ischemia. The WldSgene encodes a novel Ube4b-Nmnat1 chimeric protein (WldS protein) that is responsible for conferring the neuroprotective phenotype. How the chimeric WldS protein confers neuroprotection remains controversial, but several studies have shown that expression in neurons in vivo and in vitro modifies key cellular pathways, including; NAD biosynthesis, ubiquitination, the mitochondrial proteome, cell cycle status and cell stress. Whether similar changes are induced in non-neuronal tissue and organs at a basal level in vivo remains to be determined. This may be of particular importance for the development and application of neuroprotective therapeutic strategies based around WldS-mediated pathways designed for use in human patients.
Results
We have undertaken a detailed analysis of non-neuronal WldSexpression in WldSmice, alongside gravimetric and histological analyses, to examine the influence of WldSexpression in non-neuronal tissues. We show that expression of WldSRNA and protein are not restricted to neuronal tissue, but that the relative RNA and protein expression levels rarely correlate in these non-neuronal tissues. We show that WldSmice have normal body weight and growth characteristics as well as gravimetrically and histologically normal organs, regardless of WldS protein levels. Finally, we demonstrate that previously reported WldS-induced changes in cell cycle and cell stress status are neuronal-specific, not recapitulated in non-neuronal tissues at a basal level.
Conclusions
We conclude that expression of WldS protein has no adverse effects on non-neuronal tissue at a basal level in vivo, supporting the possibility of its safe use in future therapeutic strategies targeting axonal and/or synaptic compartments in patients with neurodegenerative disease. Future experiments determining whether WldS protein can modify responses to injury in non-neuronal tissue are now required.
Background
Degeneration of axonal and/or synaptic compartments of neurons is an early and pathologically important process in many disorders of the human nervous system, ranging from Alzheimer's disease and Batten disease through to multiple sclerosis and motor neuron disease [1–8]. Therapies designed to specifically delay or halt the progression of axonal and synaptic degeneration are therefore actively being sought for a wide range of neurological disorders.
The most robust delay in axonal and synaptic degeneration reported to date in animal models of neurological disorders has been generated by the introduction of the slow Wallerian degeneration (WldS) gene. To date, the WldSgene has been shown to significantly modify disease onset and/or progression in animal models of traumatic axonal injury [9, 10], Parkinson's disease [11, 12], demyelinating neuropathies [13], some forms of motor neuron disease [14] and cerebral ischemia [15]. These experiments highlight the potential for using the WldS protein and/or its downstream molecular interactions to generate novel therapeutic approaches for the treatment of neurological disorders. Importantly, the ability to successfully deliver the WldSgene and confer robust neuroprotection using gene therapy approaches [16, 17] has opened up the possibility of directly delivering WldS-related therapies to human patients.
The chimeric WldSgene occurred as the result of a spontaneous mutation in the C57BL/6 line of mice (originally termed C57BL/6/Ola [9]), resulting in a tandem triplication of a region already present on the distal region of chromosome 4. Mice carrying the WldSmutation are otherwise indistinguishable from their C57BL/6J strain mates in genotyping of more than 50 microsatellite markers and restriction fragment length polymorphisms (RFLPs [18–20]). The triplicated region contains sequences coding for Nmnat1, Rbp7 and Ube4b [21]. The boundaries within the triplicated region result in 2 copies of a fusion gene comprising the N70 terminal amino acids of Ube4b and the entire coding region of Nmnat1 (C Terminal 285 amino acids), linked by 18 amino acids from the 5' untranslated region of Nmnat1 which are not normally expressed [18, 21, 22]. The chimeric portion of the triplication (i.e. the N-70 Ube4b/Nmnat1 C-303 chimera) has been shown to be sufficient to recapitulate the WldSphenotype through the generation of transgenic lines in mice, rats and drosophila [23–25].
Although the WldSgene has obvious therapeutic potential, its mechanism of action remains unclear. However, several studies have shown that expression of WldS protein in neurons in vivo and in vitro induces changes in core cellular pathways, including; NAD biosynthesis, ubiquitination, the mitochondrial proteome, cell cycle status and cell stress [17, 26–28]. Even though the extent to which each of these modifications contribute to the neuroprotective phenotype remains unclear, the fact that WldSmodifies key cellular pathways raises potential problems for its use as a therapeutic agent that have yet to be investigated. For example, it is conceivable that changes in NAD biosynthesis pathways and/or cell cycle pathways in non-neuronal organs and tissues may alter their form and/or function.
Here, we have undertaken the first detailed study of the effects of WldSexpression in non-neuronal tissues in vivo. We show that WldS protein is expressed at differing levels in a range of non-neuronal organs in WldSmice. Systemic expression of WldSdid not affect overall body weight or growth. Gravimetric and histological analysis of a wide range of organs and tissues confirmed no changes in WldSmice. We also demonstrate that previously reported alterations in cell cycle and cell stress proteins reported in WldSbrain tissue are a neuronal-specific response not observed in non-neuronal organs in vivo.
Results
WldSexpression is not limited to neuronal tissue in vivo
Despite numerous reports in the literature concerning the therapeutic potential of the WldSgene (see background above), no previous studies have undertaken a rigorous assessment of the consequences of WldSexpression in non-neuronal tissue. We first examined the expression of WldS protein and RNA levels in a variety of organs from WldSmice and wild-type controls and compared expression levels to those observed in the cerebellum [29, 30]. Organs examined included liver, kidney, heart, lung and spleen. We used quantitative fluorescent western blotting techniques to assess and compare protein expression levels using a proven antibody for the WldS protein (Wld-18 antibody [23, 30, 31]; Figure 1). Example bands are shown in Figure 1A for liver (which had little to no WldS protein expression), spleen (intermediate levels of expression) and the cerebellum (strong expression).
These experiments showed that WldS protein expression was not limited to neuronal tissue, but that it was not strongly expressed in all organs examined (Figure 1B). For example, the liver had the lowest expression at 0.06 ± 0.09 (mean ± SEM) fold increase compared to wild-type background signal, the spleen showed a 6.27 ± 1.05 fold increase, whereas the cerebellum showed a 17.82 ± 0.96 fold increase. We also examined RNA expression in WldSmice (Figure 1C) and found that RNA expression varied greatly between different organs and did not necessarily correlate with protein expression. For example, the liver (which showed the lowest protein expression of the organs examined) had relatively high RNA expression levels, approaching those observed in the cerebellum. Taken together, these findings demonstrate that WldS protein and RNA are present in a range of non-neuronal organs at differing levels, but also demonstrate that the presence of RNA does not always indicate that WldS protein will also be present at comparable levels.
The observation that WldS protein is strongly expressed in non-neuronal tissues led us to investigate whether there would be sufficient protein in tail tips to facilitate accurate genotyping of WldSmice using western blotting. We found that quantitative western blotting techniques easily distinguished between wild-type, heterozygous and homozygous WldSmice (Figure 2).
Systemic expression of WldSdid not affect gross appearance or growth rates
In order to test whether systemic WldSexpression affected total body weight, mice were bred from parents heterozygous for the WldSmutation (see methods). Litters from this heterozygote cross contained mice which were null for WldS(WT), mice which were heterozygous for WldS(Het) and mice which were homozygous for WldS(WldS). All experimental comparisons were carried out within litters to remove any potential effects of background strain. There were no obvious qualitative differences in the size or behaviour of mice within litters. Figure 3A shows 5 female mice from the same experimental litter (containing a mixture of WT, Het and WldSmice), indistinguishable from one another. Mice were weighed at regular intervals post weaning up to 2 months of age. There were no significant differences between the body weights of WT, Het and WldSmice at any time-point examined (P > 0.2, ANOVA; Figure 3B; Het data not shown; N = 7 WT, N = 5 WldS).
WldSexpression did not affect gravimetrics or histopathology of non-neuronal tissue
Detailed necropsies were carried out by an experienced rodent pathologist (DGB) on WT, Het and WldSlittermates to determine if non-neuronal expression of WldS protein had any affects on tissue gravimetrics (Table 1) or histopathology (Figure 4). Organs examined for gravimetrics included kidneys, liver, spleen, thymus, heart and whole brain. In order to minimize the effects of natural biological variability within litters data were expressed as organ weight per grams/body weight. No significant differences were observed between mice from any of the 3 genotypes (Table 1). Mice were also examined for alterations in body fat deposits (interscapular, pelvic, subcutaneous and mesenteric), with no evident differences (data not shown).
Histopathological assessments were carried out on the following organs and tissues: kidney, heart, lungs, mediastinum, liver, gallbladder, urinary bladder, vagina, uterus, ovary, spleen, pancreas, lymph nodes, salivary gland, pituitary gland, adrenal gland, stomach, intestines (6 levels), calvarial bone, femur, tibia, knee joint, spine and spinal cord (4 levels, transverse sections), eyes, head, various sympathetic and parasympathetic ganglia, brain (transverse sections at 250 μm intervals). No significant differences were observed between any of the genotypes. Example sections for comparison are shown in Figure 4. Figure 4A shows representative images of liver from wild-type and WldSmice, a tissue with little to no detectable WldS protein expression (see Figure 1). Note the presence of normal hepatocyte nuclei, sinusoids and central veins in both images. Figure 4B shows representative images of kidney cortex, a tissue with intermediate levels of WldS protein expression, showing the presence of normal glomeruli, Bowman's capsules and cortical tubular profiles. Figure 4C shows representative images of spleen, a tissue with high WldS protein expression, with normal red pulp and white pulp lymphoid accumulations.
Cell cycle and cell stress alterations are specific to neuronal tissue
We have previously reported alterations in proteins involved with cell cycle and cell stress in non-injured neural tissue from WldSmice in vivo and in vitro [26, 27]. In order to determine whether similar changes were instigated in non-neuronal organs and tissues expressing WldS protein we examined expression levels of the cell stress marker antiphosphohistone H2Ax (H2Ax) and a marker of cell cycle progression acetylated histone H3 (H3) in liver, kidney, heart, lung, spleen and cerebellum from wild-type and WldSmice. Example bands for both of these proteins are shown in Figure 5A. As previously demonstrated there was a significant (P < 0.001; unpaired t-test) increase in expression of both cell stress and cell cycle markers in WldScerebellum compared to wild-type (Figure 5). However, no changes in expression of either of these proteins were found in any of the non-neuronal organs examined (Figure 5). Thus, previously reported differences in cell cycle and cell stress status appear to be a neuronal-specific response to expression of WldSat a basal level.
Discussion
Here we have shown that WldSRNA and protein are expressed at differing levels in a range of non-neuronal organs in WldSmice but did not influence overall body weight or growth. Gravimetric and histological analysis of a wide range of organs demonstrated that the presence of WldSRNA and/or protein had no overt influence on non-neuronal tissues at a basal level. We have also shown that previously reported alterations in cell cycle and cell stress proteins reported in WldSbrain tissue are neuronal-specific and are not observed in non-neuronal organs in vivo. It will now be of interest to establish whether WldS protein can modify responses to injury in non-neuronal tissues and organs, where it is expressed. Expression data in the current study show that the spleen has a comparatively high level of protein, suggesting that this organ may be useful for such studies.
These data demonstrate that downstream consequences of WldSexpression, incorporating pathways including NAD biosynthesis, ubiquitination, the mitochondrial proteome, cell cycle status and cell stress [17, 26–28], do not have any major adverse effects on non-neuronal organs. This suggests that the utilization of WldS-based therapeutics for treating neurodegenerative conditions can be considered safe for other body systems, should the treatment spread beyond the confines of the nervous system (e.g. unintentionally or as a result of systemic administration). Studies reporting that WldS-mediated neuroprotection (as well as many of its downstream effectors such as Nmnat pathways) can be successfully delivered to the nervous system using approaches such as viral gene delivery suggest that WldS-based therapeutics are a realistic possibility [16, 17].
Our experimental data have also revealed nervous system-specific effects of WldSexpression. The finding that modifications in cell cycle and cell stress status previously reported in neurons expressing WldS[27] are not replicated in non-neuronal tissues suggests that neurons may have distinct intrinsic responses to the presence of WldS. One possible explanation for this is that neurons are terminally differentiated cells whose cell cycle status is markedly different from many non-neuronal cells (for review see [32]). Whether or not this contributes directly to the neuroprotective phenotype remains to be determined. Nevertheless, these data support the hypothesis that WldSacts by targeting a specific step(s) in degenerative pathways intrinsic to neurons [33].
Conclusions
We conclude that expression of WldS protein has no adverse effects on non-neuronal tissue at a basal level in vivo, supporting the possibility of its safe use in future therapeutic strategies targeting axonal and/or synaptic compartments in patients with neurodegenerative disease.
Methods
Mouse breeding
Natural mutant C57Bl6/WldS (WldS) mice and C57Bl/6 (wild-type) mice were obtained from Harlan Olac Laboratories (Bicester, UK) and housed within the animal care facilities in Edinburgh. All animal experiments were carried out in accordance with the guidance and rules of, and under license from, the UK Home Office. Breeding pairs made up of one WldSmouse and one wild-type mouse were used to generate heterozygous WldSmice. These mice were then bred to produce litters which contained mice null for the WldSmutation (wild-type), mice heterozygous for the mutation (Het) and mice homozygous for the mutation (WldS). All data were obtained from tissue harvested from 1-2 month old mice. For body weight measurements, mice were weighed every 2 days post weaning. A minimum of 3 mice were used per group for all experiments.
Genotyping
Mice were bred as detailed above, ear-notched and assigned individual identifying numbers which were used so the experimenter remained blind to the genotype of individual mice throughout. Mice were genotyped post mortem and their genetic status was only assigned after data collection and analysis was complete. Mice were initially genotyped by quantitative western blotting for WldS protein expression levels using protein extracted from tail tips using similar methodology described below (see Figure 2). These genotypes were all validated by real-time PCR as previously described [34].
Necropsy
Mice were killed with carbon dioxide gas and immediately weighed. Selected organs were weighed and a standard panel of organs were immersion-fixed in 10% neutral-buffered formalin for histopathology. Fixed organs were embedded in paraffin, sectioned at 4 mm, and stained with hematoxylin and eosin. All analyses were undertaken with the investigator blind to the genotype of each animal.
RNA extraction & qRT-PCR
Cerebellum, liver, spleen, thymus, lung, and heart from 6-week-old female WldSmice were flash frozen on dry ice and mRNA was extracted using the RNAEasy Kit (Qiagen, Valencia, CA). Messenger RNA from all tissues was transformed into cDNA using the Superscript III kit (Invitrogen, Carlsbad, CA). Quantitative real-time PCR (qRT-PCR) was performed to examine WldSgene expression using a Sybr-Green '1-step qRT-PCR kit' (Invitrogen) on an ABI PRISM 7700 Instrument (Applied Biosystems, Foster City, CA). The following primer sequences were used:
WldS-726F TGTGCCCAAGGTGAAATTGC
WldS-818R ACGATTTGCGTGATGTCCTCC
β-actin was used as a control gene. To verify that there was minimal genomic DNA contamination, we also performed qRT-PCR analysis of selected extracted mRNA samples prior to conversion to cDNA, which demonstrated a negligible genomic DNA presence (10,000× less).
Protein extraction & quantitative western blotting
Mice were killed by cervical dislocation and organs for examination rapidly removed. Protein was extracted from tail tips, cerebella and organs including the kidney, liver, heart, lung and spleen of age- and sex-matched mice in RIPA buffer with 10% protease inhibitor cocktail (Sigma) as previously described [26, 27]. 30 μg of protein per lane was separated by SDS/Polyacrylamide gel electrophoresis on 4-20% pre-cast NuPage 4-12% Bis Tris gradient gels (Invitrogen) and then transferred to PVDF membrane overnight. The membranes were then blocked using Odyssey blocking buffer (Li-COR) and incubated with primary antibodies as per manufacturers instructions (anti acetyl Histone H3 - Lake Placid Biologicals; antiphosphohistone H2Ax - Upstate; anti beta actin and anti beta-III-tubulin - Abcam). Wld-18 antibodies were a kind gift from Dr Michael Coleman and were used as previously described [30]. Odyssey secondary antibodies were added according to manufacturers instructions (Goat anti rabbit IRDye 680 and Goat anti mouse IRDye 800). Blots were imaged using an Odyssey Infrared Imaging System (Li-COR Biosciences). Scan resolution of the instrument ranges from 21-339 μm and in this study blots were imaged at 169 μm. Quantification was performed on single channels with the Li-COR analysis software provided, as previously described [26, 27].
References
Raff MC, Whitmore AV, Finn JT: Axonal self-destruction and neurodegeneration. Science. 2002, 296: 868-871. 10.1126/science.1068613.
Wishart TM, Parson SH, Gillingwater TH: Synaptic vulnerability in neurodegenerative disease. J Neuropathol Exp Neurol. 2006, 65: 733-739. 10.1097/01.jnen.0000228202.35163.c4.
Selkoe DJ: Alzheimer's disease is a synaptic failure. Science. 2002, 298: 789-791. 10.1126/science.1074069.
Partanen S, Haapanen A, Kielar C, Pontikis C, Alexander N, Inkinen T, Saftig P, Gillingwater TH, Cooper JD, Tyynelä J: Synaptic changes in the thalamocortical system of cathepsin D-deficient mice: A model of human congenital neuronal ceroid-lipofuscinosis. J Neuropathol Exp Neurol. 2008, 67: 16-29. 10.1097/nen.0b013e31815f3899.
Kielar C, Wishart TM, Palmer A, Dihanich S, Wong AM, Macauley SL, Chun C-H, Sands MS, Pearce D, Cooper JD, Gillingwater TH: Molecular correlates of axonal and synaptic pathology in mouse models of Batten disease. Hum Mol Genet. 2009, 18: 4066-4080. 10.1093/hmg/ddp355.
Trapp BD, Peterson J, Ransohoff RM, Rudick R, Mörk S, Bö L: Axonal transection in the lesions of multiple sclerosis. N Engl J Med. 1998, 338: 278-285. 10.1056/NEJM199801293380502.
Fischer LR, Culver DG, Tennant P, Davis AA, Wang M, Castellano-Sanchez A, Khan J, Polak MA, Glass JD: Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol. 2004, 185: 232-240. 10.1016/j.expneurol.2003.10.004.
Murray LM, Comley LH, Thomson D, Parkinson N, Talbot K, Gillingwater TH: Selective vulnerability of motor neurons and dissociation of pre- and post-synaptic pathology at the neuromuscular junction in mouse models of spinal muscular atrophy. Hum Mol Genet. 2008, 17: 949-962. 10.1093/hmg/ddm367.
Lunn ER, Perry VH, Brown MC, Rosen H, Gordon S: Absence of Wallerian degeneration does not hinder regeneration in peripheral nerve. Eur J Neurosci. 1989, 1: 27-33. 10.1111/j.1460-9568.1989.tb00771.x.
Gillingwater TH, Ingham CA, Parry KE, Wright AK, Haley JE, Wishart TM, Arbuthnott GW, Ribchester RR: Delayed synaptic degeneration in the CNS of WldSmice after cortical lesion. Brain. 2006, 129: 1546-1556. 10.1093/brain/awl101.
Sajadi A, Schneider BL, Aebischer P: Wlds-mediated protection of dopaminergic fibres in an animal model of Parkinson disease. Curr Biol. 2004, 14: 326-330.
Hasbani DM, O'Malley KL: WldS mice are protected against the Parkinsonian mimetic MPTP. Exp Neurol. 2006, 202: 93-99. 10.1016/j.expneurol.2006.05.017.
Samsam M, Mi W, Wessig C, Zielasek J, Toyka KV, Coleman MP, Martini R: The Wlds mutation delays robust loss of motor and sensory axons in a genetic model for myelin-related axonopathy. J Neurosci. 2003, 23: 2833-2839.
Ferri A, Sanes JR, Coleman MP, Cunningham JM, Kato AC: Inhibiting axon degeneration and synapse loss attenuates apoptosis and disease progression in a mouse model of motorneurone disease. Curr Biol. 2003, 13: 669-673. 10.1016/S0960-9822(03)00206-9.
Gillingwater TH, Haley JE, Ribchester RR, Horsburgh K: Neuroprotection after transient global cerebral ischaemia in WldSmutant mice. J Cereb Blood Flow Metab. 2004, 24: 62-66. 10.1097/01.WCB.0000095798.98378.34.
Wang MS, Fang G, Culver DG, Davis AA, Rich MM, Glass JD: The WldSprotein protects against axonal degeneration: a model of gene therapy for peripheral neuropathy. Ann Neurol. 2001, 50: 773-779. 10.1002/ana.10039.
Araki T, Sasaki Y, Milbrandt J: Increased nuclear NAD biosynthesis and SIRT1 activation prevent axonal degeneration. Science. 2004, 305: 1010-1013. 10.1126/science.1098014.
Coleman MP, Conforti L, Buckmaster EA, Tarlton A, Ewing RM, Brown CM, Lyone MF, Perry VH: An 85-Kb tandem triplication in the slow Wallerian degeneration (WldS) mouse. Proc Natl Acad Sci USA. 1998, 95: 9985-9990. 10.1073/pnas.95.17.9985.
Mi W, Conforti L, Coleman MP: The slow Wallerian degeneration mutation (WldS): genotyping methods and mutation stability studies. FENS Forum Session 225-Trauma. 2002, Abstract 225.2
Mi W, Glass JD, Coleman MP: Stable inheritance of an 85 Kb triplication in C57BL/WldSmice. Mutation Res. 2003, 526: 33-37.
Lyon MF, Ogunkolade BW, Brown MC, Atherton DJ, Perry VH: A gene affecting Wallerian nerve degeneration maps distally on mouse chromosome 4. Proc Natl Acad Sci USA. 1993, 90: 9717-9720. 10.1073/pnas.90.20.9717.
Conforti L, Tarlton A, Mack TG, Mi W, Buckmaster EA, Wagner D, Perry VH, Coleman MP: A Ufd2/D4Cole1e chimeric protein and overexpression of Rbp7 in the slow Wallerian degeneration (WldS) mouse. Proc Natl Acad Sci USA. 2000, 97: 11377-11382. 10.1073/pnas.97.21.11377.
Mack TGA, Reiner M, Beirowski B, Mi W, Emanuelli M, Wagner D, Thomson D, Gillingwater T, Court F, Conforti L, Shama Fernando F, Tarlton A, Andressen C, Addicks K, Magni G, Ribchester RR, Perry VH, Coleman MP: Wallerian degeneration of injured axons and synapses is delayed by a Ube4b/Nmnat chimeric gene. Nat Neurosci. 2001, 4: 1199-1206. 10.1038/nn770.
Adalbert R, Gillingwater TH, Haley JE, Bridge K, Beirowski B, Berek L, Wagner D, Grumme SG, Thomson D, Addicks K, Ribchester RR, Coleman MP: A rat model of slow Wallerian degeneration (WldS) with improved preservation of neuromuscular synapses. Eur J Neurosci. 2005, 21: 271-277. 10.1111/j.1460-9568.2004.03833.x.
MacDonald JM, Beach MG, Porpiglia E, Sheehan AE, Watts RJ, Freeman MR: The Drosophila cell corpse engulfment receptor Draper mediates glial clearance of severed axons. Neuron. 2006, 50: 869-881. 10.1016/j.neuron.2006.04.028.
Wishart TM, Paterson JM, Short DM, Meredith S, Robertson KA, Sutherland C, Cousin MA, Dutia MB, Gillingwater TH: Differential proteomics analysis of synaptic proteins identifies potential cellular targets and protein mediators of synaptic neuroprotection conferred by the slow Wallerian degeneration (Wlds) gene. Mol Cell Proteomics. 2007, 6: 1318-1330. 10.1074/mcp.M600457-MCP200.
Wishart TM, Pemberton HN, James SR, McCabe CJ, Gillingwater TH: Modified cell cycle status in a mouse model of altered neuronal vulnerability (Wallerian Degeneration Slow; WldS). Genome Biol. 2008, 9 (6): R101-10.1186/gb-2008-9-6-r101.
Yahata N, Yuasa S, Araki T: Nicotinamide mononucleotide adenylyltransferase expression in mitochondrial matrix delays Wallerian degeneration. J Neurosci. 2009, 29: 6276-6284. 10.1523/JNEUROSCI.4304-08.2009.
Gillingwater TH, Wishart TM, Chen PE, Haley JE, Robertson K, MacDonald SH-F, Middleton S, Wawrowsky K, Shipston MJ, Melmed S, Wyllie DJA, Skehel PA, Coleman MP, Ribchester RR: The neuroprotective WldSgene regulates expression of PTTG1 and erythroid differention regulator 1-like gene in mice and human cells. Hum Mol Genet. 2006, 15: 625-635. 10.1093/hmg/ddi478.
Wilbrey A, Haley J, Wishart T, Conforti L, Morreale G, Beirowski B, Babetto E, Adalbert R, Gillingwater TH, Smith T, Wyllie DJA, Ribchester RR, Coleman MP: VCP binding influences intracellular distribution of the slow Wallerian degeneration protein, WldS. Mol Cell Neurosci. 2008, 38: 325-340. 10.1016/j.mcn.2008.03.004.
Fang C, Bernardes-Silva M, Coleman MP, Perry VH: The cellular distribution of the WldS chimeric protein and its constituent proteins in the CNS. Neuroscience. 2005, 135: 1107-1118. 10.1016/j.neuroscience.2005.06.078.
Herrup K, Yang Y: Cell cycle regulation in the postmitotic neuron: oxymoron or new biology?. Nat Rev Neurosci. 2007, 8: 368-378. 10.1038/nrn2124.
Perry VH, Brown MC, Lunn ER, Tree P, Gordon S: Evidence that very slow Wallerian degeneration in C57BL/Ola mice is an intrinsic property of the peripheral nerve. Eur J Neurosci. 1990, 2: 802-808. 10.1111/j.1460-9568.1990.tb00472.x.
Wishart TM, MacDonald SHF, Chen PE, Shipston MJ, Coleman MP, Gillingwater TH, Ribchester RR: Design of a novel quantitative PCR (QPCR)-based protocol for genotyping mice carrying the neuroprotective Wallerian degeneration slow (WldS) gene. Mol Neurodegen. 2007, 2: 21-10.1186/1750-1326-2-21.
Acknowledgements
The authors would like to thank members of the Gillingwater and Parson laboratories for helpful advice and assistance with this study. Wld-18 antibody was a kind gift from Dr Michael Coleman. The work was funded by grants from the Wellcome Trust (WT084151AIA to THG), BBSRC (BB/D001722/1 to THG), Uniformed Services University of the Health Sciences (R092EE and FS92EE to JWT) and Comprehensive Neuroscience Program (G192EZ to JWT). The opinions or assertions contained herein are the private views of the authors and are not to be construed as official or as reflecting the views of the United States Department of the Navy or the Department of Defense.
Author information
Authors and Affiliations
Corresponding author
Additional information
Authors' contributions
TMW participated in the design of the study, carried out experiments, analysed data and drafted the manuscript. DGB carried out necropsy experiments and analysed data. DT carried out experiments. AMT/KMB/JWT carried out QPCR experiments. THG conceived of the study, participated in its design and coordination, analysed data and drafted the manuscript. All authors read and approved the final manuscript.
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
Rights and permissions
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
About this article
Cite this article
Wishart, T.M., Brownstein, D.G., Thomson, D. et al. Expression of the neuroprotective slow Wallerian degeneration (WldS) gene in non-neuronal tissues. BMC Neurosci 10, 148 (2009). https://doi.org/10.1186/1471-2202-10-148
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/1471-2202-10-148