Table 3

List of the miRNA primers used in quantitative real time PCR analysis in compression wood and tension wood of 2 years old A. mangium.

Sequence ID

Sequence ( 5’ ➙ 3’ )

miRNA family


87(21)

TTTGGATTGAAGGGAGCTCTA

amg-miR159


4(21)

TCGCTTGGTGCAGGTCGGGAA

amg-miR168


10(21)

AGAATCTTGATGATGCTGCAG

amg-miR172


622(21)

TTGGCATTCTGTCCACCTCCC

amg-miR394


Ong and Wickneswari BMC Genomics 2011 12(Suppl 3):S13   doi:10.1186/1471-2164-12-S3-S13

Open Data