Table 1

Expression of mature- and pre-miRNAs in Vitis vinifera

miRNA

Sequence

Expression data

miRNA

Sequence

Expression data



A

B

C

D

A

B

C

D


MIR156A

UGACAGAAGAGAGGGAGCAC

0*

____

N

__I___

MIR171G

UUGAGCCGAACCAAUAUCACC

0

__RC

N

R*L*I*___

MIR156B

UGACAGAAGAGAGUGAGCAC

34

___C

N

______

MIR172A

UGAGAAUCUUGAUGAUGCUGCAUC

4

_S_C

N

______

MIR156C

UGACAGAAGAGAGUGAGCAC

34

____

N

______

MIR172B

UGAGAAUCUUGAUGAUGCUGCAUC

4

____

N

______

MIR156D

UGACAGAAGAGAGUGAGCAC

34*

LSRC

N

______

MIR172D

AGAAUCUUGAUGAUGCUGCAU

0

____

N

_LIBgBv_

MIR156E

UGACAGAGGAGAGUGAGCAC

0

____

N

______

MIR172C

GGAAUCUUGAUGAUGCUGCAG

0

____

N

_LIBgBv_

MIR156F

UUGACAGAAGAUAGAGAGCAC

926

_S__

N

RLIBgBvBm

MIR319B

UUGGACUGAAGGGAGCUCCCU

1

____

N

RLIBgBvBm

MIR156G

UUGACAGAAGAUAGAGAGCAC

923*

LS_C

N

RLIBgBvBm*

MIR319C

UUGGACUGAAGGGAGCUCCCU

1

_S__

N

RLIBgBvBm

MIR156I

UUGACAGAAGAUAGAGAGCAC

923*

_S__

N

RLIBg*BvBm

MIR319E

UUUGGACUGAAGGGAGCUCCU

0

_S_C

Y

RLIBgBvBm

MIR156H

UGACAGAAGAGAGAGAGCAU

0

LS__

Y

______

MIR319G

UUGGACUGAAGGGAGCUCCCA

2

___C

N

RLIBgBvBm

MIR159A

CUUGGAGUGAAGGGAGCUCUC

0

____

N

RLIBgBvBm

MIR319F

UUGGACUGAAGGGAGCUCCCU

1

_S__

N

RLI*BgBv*Bm*

MIR159B

CUUGGAGUGAAGGGAGCUCUC

0

____

N

RLIBgBvBm

MIR390

AAGCUCAGGAGGGAUAGCGCC

1

_S__

N

RLIBgBvBm

MIR159C

UUUGGAUUGAAGGGAGCUCUA

173

LSRC

N

RLIBgBvBm

MIR393A

UCCAAAGGGAUCGCAUUGAUC

1

____

Y

RLIBgBvBm

MIR160A

UGCCUGGCUCCCUGAAUGCCAUC

1

____

N

RLI*BgBv*Bm*

MIR393B

UCCAAAGGGAUCGCAUUGAUC

1

LS__

Y

RLIBgBvBm

MIR160B

UGCCUGGCUCCCUGAAUGCCAUC

1

____

Y

RLIBgBvBm

MIR394A

UUGGCAUUCUGUCCACCUCCAU

1

_S__

N

______

MIR160E

UGCCUGGCUCCCUGAAUGCCAUC

1

____

Y

RLIBgBvBm

MIR394B

UUGGCAUUCUGUCCACCUCC

0

LS_C

N

______

MIR160C

UGCCUGGCUCCCUGUAUGCCA

2*

_SRC

N

RLIBgBvBm*

MIR394C

UUGGCAUUCUGUCCACCUCCAU

2

____

N

______

MIR160D

UGCCUGGCUCCCUGUAUGCCA

2

____

N

RLIBgBvBm

MIR395A

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR160F

UGCCUGGCUCCCUGUAUGCCA

2

____

N

RL*IBg*Bv*Bm

MIR395B

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR162

UCGAUAAACCUCUGCAUCCAG

5

LS_C

Y

RLIBgBvBm

MIR395C

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLI*BgBvBm

MIR164A

UGGAGAAGCAGGGCACGUGCA

7

____

N

RLIBg__

MIR395D

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR164C

UGGAGAAGCAGGGCACGUGCA

7

L___

N

RLIBg__

MIR395E

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR164D

UGGAGAAGCAGGGCACGUGCA

7

____

N

RLIBg__

MIR395F

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR164B

UGGAGAAGCAGGGCACAUGCU

0

____

N

_LI*Bg__

MIR395L

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR166A

UCGGACCAGGCUUCAUUCC

43*

LSRC

Y

RLIBgBvBm

MIR395M

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR166B

UCGGACCAGGCUUCAUUCC

43*

LS__

N

RLIBgBvBm

MIR395G

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR166C

UCGGACCAGGCUUCAUUCCCC

63*

LSRC

N

RLIBgBvBm

MIR395H

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR166D

UCGGACCAGGCUUCAUUCCCC

63

_S__

N

RLIBgBvBm

MIR395I

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR166E

UCGGACCAGGCUUCAUUCCCC

63*

_SRC

N

R*LI*Bg*Bv*Bm*

MIR395J

CUGAAGUGUUUGGGGGAACUC

0

_S__

N

RLIBgBvBm

MIR166F

UCGGACCAGGCUUCAUUCCCC

63*

____

N

RLIBgBvBm

MIR395K

CUGAAGUGUUUGGGGGAACUC

0

____

N

RLIBgBvBm

MIR166G

UCGGACCAGGCUUCAUUCCCC

63*

____

N

RLIBgBvBm*

MIR395N

CUGAAGAGUCUGGAGGAACUC

0

____

N

_L____

MIR166H

UCGGACCAGGCUUCAUUCCCC

63

_S_C

N

RLIBgBvBm

MIR396B

UUCCACAGCUUUCUUGAACU

0*

LS_C

N

RL_Bg__

MIR167A

UGAAGCUGCCAGCAUGAUCUG

0*

L_RC

N

RLIBgBvBm

MIR396A

UUCCACAGCUUUCUUGAACUA

0

_S__

N

RL_Bg__

MIR167B

UGAAGCUGCCAGCAUGAUCUA

25

L__C

Y

RL*IBg*BvBm

MIR396C

UUCCACAGCUUUCUUGAACUG

0

____

N

RL_Bg__

MIR167C

UGAAGCUGCCAGCAUGAUCUC

0

____

N

RLIBgBvBm

MIR396D

UUCCACAGCUUUCUUGAACUG

0

_S_C

N

RL_Bg__

MIR167D

UGAAGCUGCCAGCAUGAUCUA

6

LS__

N

RLIBgBvBm

MIR397A

UCAUUGAGUGCAGCGUUGAUG

2*

LS_C

N

R__Bg__

MIR167E

UGAAGCUGCCAGCAUGAUCUA

30

____

N

RLIBgBvBm

MIR397B

UCAUUGAGUGCAGCGUUGAUG

2*

____

N

R__Bg__

MIR168

UCGCUUGGUGCAGGUCGGGAA

3*

LSRC

Y

RLIBgBvBm

MIR398A

UGUGUUCUCAGGUCACCCCUU

0

_SRC

N

RL_Bg__

MIR169B

UGAGCCAAGGAUGGCUUGCCG

0

____

N

_L__BvBm

MIR398B

UGUGUUCUCAGGUCGCCCCUG

2

LSRC

N

R__Bg__

MIR169H

UGAGCCAAGGAUGGCUUGCCG

0

____

N

_L__ BvBm

MIR398C

UGUGUUCUCAGGUCGCCCCUG

2*

LSRC

N

R__Bg__

MIR169A

CAGCCAAGGAUGACUUGCCGG

0

____

N

_LIBgBvBm

MIR399A

UGCCAAAGGAGAAUUGCCCUG

0

L___

N

R_I___

MIR169C

CAGCCAAGGAUGACUUGCCGG

0

____

N

_LIBgBvBm

MIR399H

UGCCAAAGGAGAAUUGCCCUG

0

L___

N

R_I___

MIR169J

CAGCCAAGGAUGACUUGCCGG

0

____

N

_LIBgBvBm

MIR399B

UGCCAAAGGAGAGUUGCCCUG

0

____

N

R__Bg_Bm

MIR169K

CAGCCAAGGAUGACUUGCCGG

0

____

N

_LIBgBvBm

MIR399C

UGCCAAAGGAGAGUUGCCCUG

0

____

N

R__Bg_Bm

MIR169S

CAGCCAAGGAUGACUUGCCGG

0

____

N

_LI*BgBvBm

MIR399I

CGCCAAAGGAGAGUUGCCCUG

1

L_RC

N

R__Bg_Bm

MIR169W

CAGCCAAGGAUGACUUGCCGG

0

____

N

_LIBgBvBm

MIR399D

UGCCAAAGGAGAUUUGCUCGU

0

____

N

______

MIR169L

GAGCCAAGGAUGACUUGCCGU

0

____

N

_LIBgBvBm

MIR399E

UGCCAAAGGAGAUUUGCCCGG

0

___C

N

______

MIR169M

GAGCCAAGGAUGACUUGCCGG

0

____

N

_LI*BgBv*Bm*

MIR399F

UGCCGAAGGAGAUUUGUCCUG

0

____

N

______

MIR169N

GAGCCAAGGAUGACUUGCCGG

0

____

N

_L*I*Bg*Bv*Bm*

MIR399G

UGCCAAAGGAGAUUUGCCCCU

0

____

N

R_I__Bm

MIR169O

GAGCCAAGGAUGACUUGCCGC

0

____

N

_LIBgBvBm

MIR403A

UUAGAUUCACGCACAAACUCG

4*

____

N

RLIBgBvBm

MIR169P

GAGCCAAGGAUGACUUGCCGG

0

____

N

_LIBgBvBm

MIR403B

UUAGAUUCACGCACAAACUCG

4

____

N

RLIBgBvBm

MIR169Q

GAGCCAAGGAUGACUUGCCGG

0

____

N

_LIBgBvBm

MIR403C

UUAGAUUCACGCACAAACUCG

4*

___C

N

RLI*BgBvBm*

MIR169E

UAGCCAAGGAUGACUUGCCUGC

1

L___

N

_LIBgBvBm

MIR403D

UUAGAUUCACGCACAAACUCG

4

____

N

RLIBgBvBm

MIR169F

CAGCCAAGGAUGACUUGCCGA

0

___C

N

_LIBgBvBm*

MIR403E

UUAGAUUCACGCACAAACUCG

4*

____

N

RLIBgBvBm

MIR169G

CAGCCAAGGAUGACUUGCCGA

0

_S__

N

_LIBgBvBm

MIR403F

UUAGAUUCACGCACAAACUCG

4*

_SRC

N

RLIBgBvBm

MIR169R

UGAGUCAAGGAUGACUUGCCG

0

____

N

_LI*BgBv*Bm*

MIR408

AUGCACUGCCUCUUCCCUGGC

6*

LSRC

Y

RLIBgBvBm

MIR169T

CGAGUCAAGGAUGACUUGCCG

0

____

N

_L*I*Bg*Bv*Bm*

MIR477

AUCUCCCUCAAAGGCUUCCAA

0

____

N

___BgBvBm

MIR169U

UGAGUCAAGGAUGACUUGCCG

0

____

N

_L*I*Bg*Bv*Bm*

MIR479

UGUGGUAUUGGUUCGGCUCAUC

2*

____

N

______

MIR169V

aAGCCAAGGAUGAAUUGCCGG

0

____

N

__IBg__

MIR482

UCUUUCCUACUCCUCCCAUUCC

5*

LSRC

Y

______

MIR169X

UAGCCAAGGAUGACUUGCCUA

0

____

Y

_LIBgBvBm

MIR535A

UGACAACGAGAGAGAGCACGC

42*

____

Y

RLIBgBvBm

MIR169Y

UAGCGAAGGAUGACUUGCCUA

0

____

N

__I___

MIR535B

UGACAACGAGAGAGAGCACGC

80*

____

Y

RLIBgBvBm

MIR169I

GAGCCAAGGAUGACUGGCCGU

0

____

N

_L_Bg__

MIR535C

UGACAACGAGAGAGAGCACGC

80*

____

Y

RLI*BgBv*Bm

MIR169D

CAGCCAAGAAUGAUUUGCCGG

0

____

N

______

MIR535D

UGACAACGAGAGAGAGCACGC

80*

____

Y

RLIBgBvBm

MIR171B

UGAUUGAGCCGCGUCAAUAUC

0

____

N

R_____

MIR535E

UGACAACGAGAGAGAGCACGC

80*

____

Y

RLIBgBvBm

MIR171C

UGAUUGAGCCGUGCCAAUAUC

4

____

N

RLIBg__

MIR828A

UCUUGCUCAAAUGAGUAUUCCA

0

____

N

______

MIR171D

UGAUUGAGCCGUGCCAAUAUC

4

____

N

RLIBg__

MIR828B

UCUUGCUCAAAUGAGUGUUCCA

0

____

N

______

MIR171A

UGAUUGAGCCGUGCCAAUAUC

4

_SRC

Y

RLIBg__

MIR845A

UAGCUCUGAUACCAAUUGAUA

0

____

N

______

MIR171I

UGAUUGAGCCGUGCCAAUAUC

4

____

N

RLIBg__

MIR845B

UAGCUCUGAUACCAAUUGAUA

0

____

N

______

MIR171E

UGAUUGAGCCGCGCCAAUAUC

0

___C

N

RLI*BgBv*Bm*

MIR845C

AGGCUCUGAUACCAAUUGAUG

0

____

N

______

MIR171H

UGGUUGAGCCGCGCCAAUAUC

0

____

N

RLIBgBvBm

MIR845D

UGGCUCUGAUACCAAUUGAUG

0

____

N

______

MIR171F

UUGAGCCGCGCCAAUAUCACU

0

_S__

N

RLIBgBv_

MIR845E

UGGCUCUGAUACCAAUUGAUG

0

____

N

______


For each predicted pre-miRNA the table reports: the mature sequence, the number of perfect matching or oligoadenylated short RNA reads observed in leaf, asterisks indicate that corresponding miRNA* sequences were also recovered by deep sequencing (column A), tissues in which significant expression of the precursor was observed by Illumina whole transcriptome sequencing (column B, where L = leaf, R = root, S = stem, C = callus), the presence of 454 reads including the precursor sequence in leaf (column C, where Y = yes, N = no), and tissues where the Combimatrix oligoarray showed significant expression of the mature sequence (column D, where L = leaf, I = inflorescence, R = root, Bg = immature berry, Bv = veraison, Bm = mature berry). Asterisks indicate signal detected for precursor in that tissue. Mature miRNAs are ordered to reflect expected cases of crosshybridization for oligonucleotide arrays. For all microRNAs, chromosome, strand and coordinates of the precursor miRNA are provided (scaffold coordinates indicate that the miRNA was situated on a scaffold not incorporated into the 8.4× genome assembly).

Mica et al. BMC Genomics 2010 11:109   doi:10.1186/1471-2164-11-109

Open Data