Table 2

G4 and pTTSs overlapping in the MYC promoter and MYC intragenic regions pTTSs overlapped with G4s are in bold type.

G4 ID

Sequence

Chr

Start

End

Strand

TSS ID


Quad-8-CCC-5773

CCCCACCTTCCCCACCCTCCCCACCCTCCCCATAAGCGCCCCTCCCGGGTTCCC

Chr8

128817351

128817404

-

TSS15008128817345

TSS15008128817365

Quad-8-CCC-5771

CCCCCTGCCCCTCCCATATTCTCCC

Chr8

128816440

128816464

-

TSS15008128816440


Jenjaroenpun and Kuznetsov BMC Genomics 2009 10(Suppl 3):S9   doi:10.1186/1471-2164-10-S3-S9

Open Data