Table 2

Primers used for WC1 transcript amplification and for cDNA clone sequencing reactions

Primer name

Sequence (5'-3')


Primers used for gene amplification:

WC1atg-for

ATGGCTCTGGGCAGACACCTCTC

WC1full-forA

GATGGTTACAGGTGGACATTGAAGG

WC1group1,2-rev

TCAYGAGAAAGTCAYTGKGGATG

WC1group3-rev

CTACATGGTGCTAAGCTCCACATC

WC1group4-rev

TCATCTCCTAGTTAATACAGCATC

SRCR1-rev

TGCACAGATGACCTGGGCAGTGG

Primers used for sequencing reactions:

WC1seq1-for

CTCAACCTACAGGCTCTG

WC1seq2-for

CAGGTGGAGATGAACATTTC

WC1seq3-for

CACGACTGCAGACACAAGC

WC1seq4-for

GAAGACATCACTGTGTCCGTG

WC1seq5-for

GAGAAGCCCTCAATGCCAC

WC1seq6-for

CATGGAAGACATCACTGTG

WC1seq7-for

GCTACACAGATGGAGAGCAG

WC1seq8-for

GGCTCATGACAAACGGCTCCTCTCAG

WC1seq1-rev

GAGCTTCTCTCTGTCTGTGCAG

WC1seq2-rev

GCAGCACAGTCCCACAG

WC1seq3-rev

GCCCTTCCCCAAAGTGAGCTG

WC1seq4-rev

CTGGTCAAGGATCTCCACTCTC

WC1seq5-rev

GATCCTGCCCCAAAGTGAGC

WC1seq6-rev

GTGTGAAGTTTCCATCAGAC

WC1seq7-rev

GCAGTAGGGAGAACTCTC


Herzig and Baldwin BMC Genomics 2009 10:191   doi:10.1186/1471-2164-10-191

Open Data