Table 1

Characterization of the polymorphic microsatellite loci identified in Euphausia superba
Locus Repeat motif Primer sequence (5′-3′) Ta(°C) Allele size range (bp) A HO HE FIS
Esup1 (TGTA)10 F: TGTTTGGGTACTCACGGTCG 58 141-188 12 0.90 0.89 −0.006
R: ACGTACATCCTCAGACAGAC
Esup2 (TAG)7 F: ACCATAACCTCACTGACACC 57 103-125 5 0.36 0.37 0.053
R: ATGGTAAGGTTGCACTGGAC
Esup3 (GT)11 F: CGCATGATTGCATCGCAAAG 56 183-205 12 0.84 0.86 0.029
R: AGGCACTCTCTGTCTCACTC
Esup4 (AC)14 F: AATTTGAGAAAGCATAATACACTGAC 52 185-221 15 0.84 0.89 0.057
R: TGTGTTTGTTGTGCATGTTTGAG
Esup5 (GTA)7 F: CCAGTACCAACACTAGCACC 50 147-165 7 0.84 0.74 −0.14
R: GCTGCACTCATTCCATCCAC
Esup6 (TTG)7 F: CTATGGCGCCCACAAATTCC 50 215-279 17 0.77 0.92 0.157
R: ACAACAGCAAGAGCATCCAC
Esup7 (AG)13 F:TGCATAGATGTACAAAGAGATAGC 55 110-138 14 0.87 0.90 0.038
R: ATATCCGCATCGGCAAACAC
Esup8 (TG)16 F: GCATCAGGCTATGTTGAGGG 58 117-143 14 0.74 0.81 0.086
R: TGAATCACATGCCAATACACAC
Esup9 (TG)12 F:TTCTGGTGCCTATGAAGGGG 58 180-270 28 0.81 0.96 0.167
R: TGCTCAATGAAATATGCAATAAAGAC
Esup10 (TATC)9 F: AGCGCTATAATATCAAAAATACAACC 54 216-282 17 0.87 0.93 0.066
R: AGAAAGTCCCTTTTTGCACG

The following details are reported: name, motif, primer sequence and annealing temperature (Ta°C). Also descriptive statistics are presented, number of alleles A, observed (HO) and expected (HE) heterozygosities and heterozygote deficiency (FIS) according to Hardy-Weinberg equilibrium. Bold numbers indicate significant values at 0.1% level.

Candeias et al.

Candeias et al. BMC Research Notes 2014 7:73   doi:10.1186/1756-0500-7-73

Open Data