Table 1

Real-time PCR systems used to test the efficiency of stool concentration by lyophilization
Bacteria Target Sequence (5’ – 3’) Length (bp)
Methanobrevibacter smithii 16S rRNA CCGGGTATCTAATCCGGTTC 20
CTCCCAGGGTAGAGGTGAAA 20
CCGTCAGAATCGTTCCAGTCAG 22
All bacteria 16S rRNA AGAGTTTGATCMTGGCTCAG 20
TTACCGCGGCKGCTGGCAC 19
CCAKACTCCTACGGGAGGCAGCAG 24
Salmonella enterica Chorismate synthase CAAGAAATACCTGGCGGAAA 20
CGGGACAAAAGAACGGATTA 20
GTTCGGCATCGAAATCCGCG 20

M = C or A.

K = T, U or G.

Donatin and Drancourt

Donatin and Drancourt BMC Research Notes 2012 5:702   doi:10.1186/1756-0500-5-702

Open Data