Table 1

DNA sequences of RT-PCR, quantitative RT-PCR, and DNA sequencing primers
Target Sense primer (location) Antisense primer (location)
RT-PCR and DNA sequencing
NM_001175 ACTCAGAAGTCAGAGTTGAGAGAC (exon 1) AGAGAATTCTTCCAGGTGGCAAGG (exon 6/6x)
variant 6 series ACTGGGCTTTTGCTTCATTTGTTCAG (exon 1x/y/z) AGAGAATTCTTCCAGGTGGCAAGG (exon 6/6x)
CGACTGGAGCACGAGGACACTGA (5 RACE) ACGAGTGAAGCAACATGGCACAAAG (exon 1x/y/z)
ACTGGGCTTTTGCTTCATTTGTTCAG (exon 1x/y/z) GCTGTCAACGATACGCTACGTAACG (3 RACE)
AGGAGTCTTTGTGCCATGTTGCTTCAC (exon 1x/y/z) CGCTACGTAACGGCATGACAGTG (3 RACE)
GGACACTGACATGGACTGAAGGAGTA (5 RACE) ACTCCTGAACAAATGAAGCAAAAGCCCC (exon 1x/y/z)
ACTB ATTCCTATGTGGGCGACGAGGC (exon 3) TGGATAGCAACGTACATGGCTGG (exon 4)
Quantitative RT-PCR
NM_001175 GGACAGAGACGTGAAGCACTGA (exon 1) GCTTGCTGTCCAGCTCATCA (exon 2)
variant 6a GTCTTTGTGCCATGTTGCTTCA (exon 1x/y/z) AGCTTGCTGTCCAGCTCATCA (exon 2)
ACTB TGGCACCCAGCACAATGA (exon 5) CCGATCCACACGGAGTACTTG (exon 6/6x)
Standard curves in quantitative RT-PCR
NM_001175 ACTCAGAAGTCAGAGTTGAGAGAC (exon 1) AGAGAATTCTTCCAGGTGGCAAGG (exon 6/6x)
variant 6a ACTGGGCTTTTGCTTCATTTGTTCAG (exon 1x/y/z) ACTCTCACAAACCAGGGTGAGC (exon 3)

Hatakeyama et al.

Hatakeyama et al. BMC Research Notes 2012 5:666   doi:10.1186/1756-0500-5-666

Open Data