Table 2

Primer sequences evaluated for specificity (BLAST) and primer annealing onto secondary structures (mFOLD) by in silico analysis for the eight different species
Species Primers Target gene Reference
Aggregatibacter actinomycetemcomitansa F: GCGAACGTTACGCGTTTTAC waaA Hyvarinen et al. [33]
R: GGCAAATAAACGTGGGTGAC
Aggregatibacter actinomycetemcomitans F: CTTACCTACTCTTGACATCCGAA 16S rRNA Maeda et al. [35]
RV: ATGCAGCACCTGTCTCAAAGC
Aggregatibacter actinomycetemcomitansb F: CAGCATCTGCGATCCCTGTA iktA Yoshida et al. [36]
R: TCAGCCCTTTGTCTTTCCTAGGT
Fusobacterium spp. F: AAGCGCGTCTAGGTGGTTATGT 16S rRNA Martin et al. [37]
R: TGTAGTTCCGCTTACCTCTCCAG
Fusobacterium spp.b F: CGCAGAAGGTGAAAGTCCTGTAT 16S rRNA Suzuki et al. [38]
R: TGGTCCTCACTGATTCACACAGA
Parvimonas micros F: AAACGACGATTAATACCACATGAGAC 16S rRNA Bartz et al. [39]
R: ACTGCTGCCTCCCGTAGGA
Parvimonas microsb F: AGTGGGATAGCCGTTGGAAA 16S rRNA Martin et al. [37]
R: GACGCGAGCCCTTCTTACAC
Porphyromonas gingivalis F: TGGTTTCATGCAGCTTCTTT waaA Hyvarinen et al. [33]
R: TCGGCACCTTCGTAATTCTT
Prevotella intermediab F: GACCCGAACGCAAAATACAT waaA Hyvarinen et al. [33]
R: AGGGCGAAAAGAACGTTAGG
Prevotella intermedia F: TCCACCGATGAATCTTTGGTC 16S rRNA Maeda et al. [35]
R: ATCCAACCTTCCCTCCACTC
Tannerella forsythiaa F: CTCGCTCGGTGAGTTTGAA waaA Hyvarinen et al. [33]
R: ATGGCGAAAAGAACGTCAAC
Tannerella forsythia F: GGGTGAGTAACGCGTATGTAACCT 16S rRNA Shelburne et al. [40]
R: ACCCATCCGCAACCAATAAA
Tannerella forsythiab F: TCCCAAAGACGCGGATATCA bspA antigen Morillo et al. [41]
R: ACGGTCGCGATGTCATTGT
Tannerella forsythiaa F: AGCGATGGTAGCAATACCTGTC 16S rRNA Kuboniwa et al. [42]
R: TTCGCCGGGTTATCCCTC
Tannerella forsythiaa F: ATCCTGGCTCAGGATGAACG 16S rRNA Suzuki et al. [38]
R: TACGCATACCCATCCGCAA
Treponema denticola F: CCTTGAACAAAAACCGGAAA waaG Hyvarinen et al. [33]
R: GGGAAAAGCAGGAAGCATAA
Streptococcus mutansb F: AGCCATGCGCAATCAACAGGTT gftB Yano et al. [43]
R: CGCAACGCGAACATCTTGATCAG
Streptococcus mutans F: GCCTACAGCTCAGAGATGCTATTCT gftB Yoshida et al. [36]
R: GCCATACACCACTCATGAATTGA

Legend

a: Primer pairs excluded for further in vitro testing on the basis of in silico analysis.

b: Primer pairs excluded for further specificity testing on the basis of amplification efficiency.

Decat et al.

Decat et al. BMC Research Notes 2012 5:664   doi:10.1186/1756-0500-5-664

Open Data