Table 1

Oligonucleotides used
name forward primer (5 to 3) reverse primer (5 to 3)
tga3Phusion ACGTTGGCGGGCTAAGGAGTGAACG CAAACATGCTAAAGAAGAACGATC
pII99 ACTCGTCAAGAAGGCGATAGAAGGC CAAGCAAGGTAAGTGAACGACCCG
tga3Probe GAATCCAAACCTCCTCGTCC GCAGAATCCATCAGGTAAAACTC
tga3PromFw CATCAATCCATCATCAGTCCAAG
tga3TermRev CCTCTCTCATTTGCTCAACTC
M13Fw GTTTTCCCAGTCACGAC
tga3LocusCheck CTTGGAGTCTGCGTGCG
Mut-tga3 GACTACCAAGCAGAATCCGG TGATTGAACCGCCATAGCAG

Gruber et al.

Gruber et al. BMC Research Notes 2012 5:641   doi:10.1186/1756-0500-5-641

Open Data