Table 3

Gene identification and primers sequences used in the qPCR analyses
Gene Primer   Primer sequence (5’-3’) Amplicon (bp)* Amplification efficiency (%)**
Elongation factor-1α Forward CCTGTCCTTGATTGTCACACTTCC 130 110
Reverse CCATTCCAGCATCACCGTTCTTC
Ubiquitin (E. gobulus) Forward TCCGTCAAAAGCGAACAGA 173 97
Reverse CATTTCCCTCCAGATTACCC
Ubiquitin (E. urograndis) Forward GGACTTTCGTTCGTTTTGGT 107 97
Reverse GTGATTTGGGGAGGGTTTG
Actin Forward AGATGACCCAGATTATGTTTGAGACCTTC 122 97
Reverse ACCATCACCAGAATCCAACACAATACC
SAND protein Forward TGGGTCACACAGGATTTTGA 130 100
Reverse CTCCCAGCAAAAAGATCTCG
Isocitrate dehydrogenase-NADP Forward AGTTTGAGGCTGCTGGAATC 100 103
Reverse CTTGCATGCCCACACATAAC
Histone H2B Forward AACAAGAAGCCCACCATCAC 142 96
Reverse ACAACTTCCTCCTCGCTCAC
α-Tubulin Forward CCAGTGAACAAATGCCCTCT 92 107
Reverse TGATCAGCAACAACACAGCA
Ribossomal 18S Forward CATGGCCGTTCTTAGTTGGT 71 95
Reverse TAGCAGGCTGAGGTCTCGTT
β-Tubulin Forward GATGGGGACGCTATTGATTT 225 100
Reverse CTTGGGTTGATGAGTTTCAGG

* Melting temperature = 60°C for all primers. **E=10^(-1/slope)-1.

Moura et al.

Moura et al. BMC Research Notes 2012 5:634   doi:10.1186/1756-0500-5-634

Open Data