Email updates

Keep up to date with the latest news and content from BMC Research Notes and BioMed Central.

Open Access Correction

Correction: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua

Pal A Olsvik*, Liv Softeland and Kai K Lie

Author Affiliations

National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway

For all author emails, please log on.

BMC Research Notes 2011, 4:456  doi:10.1186/1756-0500-4-456

The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1756-0500/4/456


Received:24 October 2011
Accepted:27 October 2011
Published:27 October 2011

© 2010 Olsvik et al; licensee BioMed Central Ltd.

This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Correction

Following the publication of our article[1], an error in Table 2 was noted, the wrong accession number and primer sequences were stated for the EF1A assay.

The GenBank accession number was incorrectly stated as:

EX721840

Forward primer: CCCTGTGGAAGTGGCTGAAG

Reverse primer: CATCCAAGGGTCCGTATCTCTT

The correct GenBank accession number should be:

EX722124 Forward primer: CGGTATCCTCAAGCCCAACA Reverse primer: GTCAGAGACTCGTGGTGCATCT

We apologise for any inconvenience this may have caused.

References

  1. Olsvik PA, Softeland L, Lie KK: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua.

    BMC Research Notes 2008, 1:47. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL