Limited redundancy in genes regulated by Cyclin T2 and Cyclin T1
-
* Corresponding author: Andrew P Rice arice@bcm.edu
1 Department of Molecular Virology & Microbiology, Baylor College of Medicine, Houston, TX 77030, USA
2 Department of Pathology, University of Miami Miller School of Medicine/Jackson Memorial Hospital, Miami, FL 33136, USA
BMC Research Notes 2011, 4:260 doi:10.1186/1756-0500-4-260
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1756-0500/4/260
| Received: | 12 April 2011 |
| Accepted: | 26 July 2011 |
| Published: | 26 July 2011 |
© 2011 Rice et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
The elongation phase, like other steps of transcription by RNA Polymerase II, is subject to regulation. The positive transcription elongation factor b (P-TEFb) complex allows for the transition of mRNA synthesis to the productive elongation phase. P-TEFb contains Cdk9 (Cyclin-dependent kinase 9) as its catalytic subunit and is regulated by its Cyclin partners, Cyclin T1 and Cyclin T2. The HIV-1 Tat transactivator protein enhances viral gene expression by exclusively recruiting the Cdk9-Cyclin T1 P-TEFb complex to a RNA element in nascent viral transcripts called TAR. The expression patterns of Cyclin T1 and Cyclin T2 in primary monocytes and CD4+ T cells suggests that Cyclin T2 may be generally involved in expression of constitutively expressed genes in quiescent cells, while Cyclin T1 may be involved in expression of genes up-regulated during macrophage differentiation, T cell activation, and conditions of increased metabolic activity To investigate this issue, we wished to identify the sets of genes whose levels are regulated by either Cyclin T2 or Cyclin T1.
Findings
We used shRNA lentiviral vectors to stably deplete either Cyclin T2 or Cyclin T1 in HeLa cells. Total RNA extracted from these cells was subjected to cDNA microarray analysis. We found that 292 genes were down- regulated by depletion of Cyclin T2 and 631 genes were down-regulated by depletion of Cyclin T1 compared to cells transduced with a control lentivirus. Expression of 100 genes was commonly reduced in either knockdown. Additionally, 111 and 287 genes were up-regulated when either Cyclin T2 or Cyclin T1 was depleted, respectively, with 45 genes in common.
Conclusions
These results suggest that there is limited redundancy in genes regulated by Cyclin T1 or Cyclin T2.
Background
Positive transcription elongation factor b (P-TEFb) facilitates transition from abortive to productive mRNA elongation by phosphorylating the carboxyl terminal domain (CTD) of the large subunit of RNA Polymerase II (RNA Pol II) and also the negative elongation factors NELF and DSIF [1,2]. P-TEFb is essential for expression of most RNA Pol II-transcribed genes and P-TEFb function appears to be limiting for a large number of the non-expressed set of genes in different cell types [3,4]. P-TEFb exists in two forms in cells, a core P-TEFb and a snRNP complex. Core P-TEFb consists of Cdk9 as the catalytic subunit, a Cyclin subunit either Cyclin T1 T2 or K, and a protein known as Brd4 that is involved in directing core P-TEFb to active genes that are marked by acetylated histones [5]. The snRNP form of P-TEFb is catalytically inactive despite the presence of a Cyclin subunit and Cdk9 that is phosphorylated in its T-loop [6]. In addition to the core P-TEFb, the snRNP contains 7SK snRNA, HEXIM (either HEXIM1 or HEXIM2), MePCE (BCDIN3) and PIP7S (LARP7) proteins [5]. The precise function of the snRNP form of P-TEFb is unknown but it may serve to sequester excess Cdk9 and its Cyclin partner in a complex that can be readily recruited to activate RNA Pol II elongation [7].
The expression patterns of Cyclin T1 and Cyclin T2 differ in primary monocytes and CD4+ T cells. In general, Cyclin T2 is expressed at a relatively high level in freshly isolated monocytes and its level remains constant when the cells are induced to undergo macrophage differentiation. In contrast, Cyclin T1 is expressed at low levels in monocytes and it is strongly up-regulated by a post-transcriptional mechanism when the cells are induced to differentiate to macrophages [8,9]. This up-regulation of Cyclin T1 protein expression appears to be required for the induction of a large portion of cellular mRNAs that are regulated during macrophage differentiation [10]. In resting primary CD4+ T cells, Cyclin T2 levels are also relatively high and change little following T cell activation [11]. In contrast, Cyclin T1 levels are low in resting CD4+ T cells and are strongly up-regulated following T cell activation by a post-transcriptional mechanism [11-13]. This expression pattern of Cyclin T2 and Cyclin T1 in quiescent vs. activated monocytes and CD4+ T cells suggests that Cyclin T2 may be generally involved in expression of constitutively expressed genes in quiescent cells, while Cyclin T1 may be involved in expression of genes up-regulated during macrophage differentiation, T cell activation, and conditions of increased metabolic activity [14].
HIV-1 replication requires the viral Tat protein for productive RNA Pol II transcription of the integrated provirus. Tat functions by recruiting P-TEFb to the TAR RNA element that forms at the 5' end of nascent viral transcripts, where P-TEFb can phosphorylate the CTD, NELF, and DSIF. Tat makes direct protein-protein contact with Cyclin T1 and can therefore only utilize Cyclin T1-containing P-TEFb complexes. Inhibition of P-TEFb by siRNAs against Cyclin T1, a dominant negative-Cdk9 protein, or chemical inhibitors can inhibit HIV-1 replication in vitro [15-21]. It has been proposed that P-TEFb inhibitors have therapeutic potential for treatment of HIV-1 infection or cancer. A number of studies have also shown that P-TEFb inhibitors have potential as chemotherapeutic agents for some forms of cancer, such as chronic lymphocytic leukemia [22,23] or hepatocellular carcinoma [24]. A number of Cdk9 chemical inhibitors are currently being evaluated in clinical trials for treatment of various forms of cancer [25].
The effects of various P-TEFb inhibitors on cellular growth and cytotoxicity have been described in a number of studies. Stable expression of a dominant-negative Cdk9 protein has no observable effect on growth of a number of cell lines, although it does sensitize the monocytic U937 cell line to apoptosis [18,19]. Selicilib and flavopiridol, chemical inhibitors of Cdk9, can inhibit HIV-1 replication in cell lines at concentrations that are not cytotoxic [15,16]. Transient expression of siRNAs against Cyclin T1 or Cdk9 is able to inhibit HIV-1 replication without affecting the growth rate of HeLa cells [17]. However, stable depletion of Cdk9 using an shRNA vector that targets the 55 kDa isoform of Cdk9 induces apoptosis in HeLa cells [26]. A recent study generated a knock-out of the Cyclin T2 gene in mice and showed that Cyclin T2 is essential for vertebrate embryogenesis [27]. Transcriptional profiling in murine embryonic stem (ES) cells depleted for either Cyclin T2 or Cyclin T1 by transfected siRNAs identified a limited set of Cyclin T2- and Cyclin T1-dependent genes [27].
To further evaluate the effects of inhibition of P-TEFb function on cellular physiology, in this study we have used shRNA vectors to deplete Cyclin T1 and Cyclin T2 in HeLa cells where each of these P-TEFb subunits is expressed at relatively high levels. The shRNA vectors used here allow the stable depletion of target proteins, unlike previous studies that used transfections of siRNAs against Cyclin T1 which display only a transient depletion of the target proteins [17,27]. We found that stable depletion of either Cyclin T1 or Cyclin T2 had no effect on growth rates in HeLa cells. We carried out a transcriptional profile analysis in Cyclin T1- and Cyclin T2-depleted cells and identified cellular mRNAs whose expression is dependent upon Cyclin T1, Cyclin T2, or both Cyclin proteins.
Findings
The expression patterns of Cyclin T1 and Cyclin T2 in primary monocytes and CD4+ T cells suggests that Cyclin T2 may be generally involved in expression of constitutively expressed genes in quiescent cells, while Cyclin T1 may be involved in expression of genes up-regulated during macrophage differentiation, T cell activation and conditions of increased metabolic activity [9,11,12,14].
Depletion of Cyclin T2 or Cyclin T1 in HeLa cells does not affect cell growth
We previously reported that the continuous expression of siRNAs against Cyclin T1 from a shRNA lentiviral vector displayed a stable knock-down and had no effect on the growth rate of either Jurkat CD4+ T cells or MM6 monocytic cells [10,14]. We wished to compare the effects of stable depletions of Cyclin T1 and Cyclin T2, and therefore constructed shRNA vectors that target Cyclin T2. As a control shRNA vector, we used a shRNA lentiviral vector termed MM (mismatch) which contained a four nucleotide mismatch against the Cyclin T1 mRNA that has previously been shown to have only minimal effects on cellular mRNA expression levels [10]. The target sequence against Cyclin T2 was selected by a rational design strategy to a region common to both isoforms, Cyclin T2a and T2b [28].
We first examined effects of Cyclin T2 and T1 depletions. HeLa cell cultures were transduced with lentiviral shRNA vectors against Cyclin T2, Cyclin T1 or the MM control and at five days post-transduction, flow cytometry analysis showed that > 97% of cells in all three cultures expressed the GFP marker protein (Figure 1A). We note that there are two populations of GFP+ cells, high- and low-expressors. The explanation for these two populations is not known and we did not separate these two populations in the transcriptional profiling described below. The efficiency and specificity of Cyclin T2 depletion was examined by measuring the mRNA levels of Cyclin T2 and Cyclin T1 using quantitative real-time RT-PCR. The shRNA vector against Cyclin T2 reduced Cyclin T2 mRNA levels by ~ 60% relative to cells transduced with control vector, while Cyclin T1 mRNA levels was not significantly affected (Figure 1B). Two isoforms of Cyclin T2 are expressed in HeLa cells, termed Cyclin T2a and Cyclin T2b that contain different carboxyl termini due to differential splicing [29]. An immunoblot analysis showed that the protein level of Cyclin T2a was reduced when HeLa cells were transduced with the CyclinT2 shRNA vector but not Cyclin T1 shRNA vector (Figure 1C). Cyclin T2b protein is expressed at a very low level in HeLa cells and it was found to be reduced in cells transduced with Cyclin T2 shRNA vector but not Cyclin T1 shRNA vector (data not shown). The shRNA vector against Cyclin T1 was effective in depleting Cyclin T1 and had no effect on Cyclin T2a as we have observed previously [10]. We quantified the immunoblot relative to β-actin loading control and specific protein expression in cells transduced with MM control shRNA vector. We found Cyclin T2a and Cyclin T1 protein levels were reduced by ~74% and ~70% in HeLa cells transduced with CyclinT2 or CyclinT1 shRNA vector, respectively. We also observed that Cdk9 and HEXIM1 protein levels were reduced ~10 and 27% and ~46 and 35%, respectively, when either Cyclin T2 or Cyclin T1 was depleted. Other studies have reported similar findings [14,17,27] indicating that Cdk9 protein stability is linked to expression levels of its Cyclin partners. The reduction in levels of HEXIM1 could be the result of the stoichiometry of the 7SK RNP being disturbed when expression of Cyclin T2 or T1 and consequently Cdk9 are reduced.
Figure 1. shRNA against Cyclin T2 expressed from a lentiviral vector specifically and efficiently
depletes CyclinT2 protein. (A) HeLa cells infected at an m.o.i. of five with lentiviral vectors expressing
a shRNA against Cyclin T2 (shRNA T2), Cyclin T1 (shRNA T1) or a control shRNA against
a mismatch sequence in Cyclin T1 (shRNA MM). Cultures were analyzed five days post
infection by flow cytometry. HeLa cells not treated with any shRNA were used as a
control for flow cytometry analysis. The lentiviral vectors express a GFP marker protein.
The unfilled region represents GFP background level in non-treated HeLa cells. The
percentages of GFP positive cells are indicated. (B) Total RNA was extracted from
HeLa cells transduced with shRNA T2 or shRNA MM after five days post infection and
analyzed Cyclin T2, Cyclin T1 mRNA by quantitative real time RT-PCR. The fold-change
is indicative of the transcript levels in the shRNA T2 treated cells relative to the
shRNA MM treated cells after normalization to housekeeping gene, β-actin levels. (C)
Immunoblot analysis of cell extracts prepared from HeLa cells transduced for five
days with shRNA T2, shRNA T1 or shRNA MM lentiviral vectors. Untransduced HeLa cells
(Mock) were used as control. The immunoblots were performed to analyze the levels
of Cyclin T2, Cyclin T1, Cdk9, HEXIM1 and β-actin proteins. The band intensity was
quantified using ImageJ and presented below each panel.
We examined the effect of Cyclin T2 and Cyclin T1 depletions on the growth rate of HeLa cells. Cultures were transduced with Cyclin T2 or Cyclin T1 shRNA vectors and five days later GFP positive cells in the cultures were sorted by flow cytometry. GFP positive cells were plated and MTT cell viability assays were carried out on the sorted cells at days 0, 3, 7 and 9. Cells expressing shRNA against Cyclin T2 or Cyclin T1 were not significantly affected in their viability or growth rate when compared with either mock or MM control transduced cells (Figure 2). It is possible that Cyclin T2 and Cyclin T1 may compensate each other in the activation of many genes. To investigate this, we attempted to concurrently deplete Cyclin T2 and Cyclin T1 but were not successful (data not shown). We previously observed that shRNA depletion of Cyclin T1 in monocytic MM6 cells had no observable effect on cellular viability or growth [10] while depletion of the 55 kDa isoform of Cdk9 in HeLa cells induced apoptosis [26]. We conclude from these data that the depletion of Cyclin T1 or Cyclin T2 under these conditions in HeLa cells does not affect cellular growth.
Figure 2. Cyclin T2 depletion does not affect HeLa cell growth. HeLa cells transduced with lentiviral shRNA vectors (shRNA T2, shRNA T1, shRNA MM)
for 5 days were sorted by flow cytometry for GFP expression. The sorted (105 cells) cells were plated and MTT cell growth and viability assay was performed on
days 0, 3, 7 and 9. Results are expressed as the percentage of viable cells compared
with MM control shRNA transduced cells.
Transcriptional profiling: validation and analysis of microarray data
The data presented in Figures 1 and 2 demonstrate that shRNA vectors against Cyclin T2 and Cyclin T1 are efficient and specific, and depletion of either protein in HeLa cells has no observable effect on cellular growth. This observation raises the question about the redundancy of these two Cyclin proteins for P-TEFb function. To address this issue, we carried out transcriptional profiling with DNA microarrays in cells depleted for Cyclin T2 or Cyclin T1. HeLa cells were transduced with shRNA-Cyclin T1, shRNA-Cyclin T2, or shRNA-MM Control lentiviral vector. At five days post transduction, cells were collected and total RNA was isolated. Additionally, a portion of cultures were monitored at this time for transduction efficiencies by flow cytometry using the vector GFP marker protein. Cultures were found to contain >97% GFP positive cells. Gene expression profiles were examined using the Affymetrix GeneChip Human Genome U133 PLUS 2.0 array, which contains about 54,000 probe sets representing approximately 18,953 unique (non-redundant) transcripts. Two independent biological replicate experiments were carried out in this analysis.
To assess the reliability of the microarray data, several mRNAs whose levels were differentially affected >1.2-fold by Cyclin T2 or Cyclin T1 depletions were selected for further analysis by quantitative real-time RT-PCR assays. These mRNAs were: Cyclin T2 (reduced 3.2-fold in DNA microarray data by Cyclin T2 depletion); Cyclin T1 (reduced 2-fold in DNA microarray data by Cyclin T1 depletion); HEXIM1 (reduced 2.5-fold in DNA microarray data by Cyclin T2 depletion); CRM1 (reduced 1.7-fold in DNA microarray data by Cyclin T2 depletion); OAS1 (reduced 2.5- and 2.4-fold in DNA microarray data by Cyclin T2 and Cyclin T1 depletions, respectively); MFAP5 (reduced 6.5- and 3.9-fold in DNA microarray data by Cyclin T2 and Cyclin T1 depletions, respectively); CDKN1C (reduced 2.2 and 2.6-fold in DNA microarray data by Cyclin T2 and Cyclin T1 depletions, respectively). RNA levels in real-time RT-PCR assays were normalized to GAPDH as the mRNA for this house-keeping gene was unaffected by Cyclin T2 or Cyclin T1 depletions. The transcript levels of the selected genes were analyzed from four independent biological replicate experiments. As shown in Figure 3, the changes in mRNA abundance in shRNA-Cyclin T2 and shRNA-Cyclin T1 treated cells relative to shRNA-MM control (set arbitrarily at 1.0) are in accordance with the trend seen in the microarray data. It should be noted that microarray data tend to be more compressed than that of quantitative real-time RT-PCR assays [30,31]. These data indicate that the microarray data are likely in general to be reliable.
Figure 3. Validation of microarray data. Total RNA was extracted from four independent HeLa cell infections with indicated
shRNA vectors for five days including aliquots of RNA for microarray analysis. Quantitative
real-time RT-PCR was carried out to measure the expression level of indicated mRNA.
The fold-change was calculated and represents the change in transcript levels in shRNA
T2 or T1 infected cells relative to shRNA MM treated cells after normalization to
housekeeping gene, GAPDH. Average fold-change from the four independent infections
is presented. * p < 0.05, ** p < 0.005, *** p < 0.0005 in a paired t-test.
Cellular genes are differentially affected when either Cyclin T2 or Cyclin T1 are depleted in HeLa cells
We used the transcriptional profiling data from two independent biological experiments to identify the mRNAs that were either down-regulated or up-regulated > 1.2-fold (p-value < 0.05) by either Cyclin T2 or Cyclin T1 depletions relative to their expression in cells transduced with the MM control shRNA vector. The 1.2-fold cut-off has been used in other transcriptome analysis studies [32,33]. When a fold cut-off of 1.5 was examined, 96 total genes were down-regulated in Cyclin T2 depletions and 242 total genes were down-regulated in Cyclin T1 depletions. There were 75 and 147 genes up-regulated >1.5-fold when either Cyclin T2 or CyclinT1 was depleted, respectively. The intersection of Cyclin T2 and Cyclin T1 down-regulated genes >1.5-fold contained 35 total common genes, while the intersection of up-regulated genes contained 20 common genes (data not shown). When a fold cut-off of 2.0 was examined, 17 total genes were down-regulated in Cyclin T2 depletions and 71 total genes were down-regulated in Cyclin T1 depletions. There were 16 and 28 genes up-regulated >2.0-fold when either Cyclin T2 or CyclinT1 was depleted, respectively. The intersection of Cyclin T2 and Cyclin T1 down-regulated genes >2.0-fold contained just 5 total common genes, while the intersection of up-regulated genes contained 9 common genes (data not shown). It is likely that analyzing a high fold cut-off (>1.5- and >2.0-fold) will result in a gene list containing a number of false-negatives; conversely, analyzing a small fold cut-off (1.2-fold) will likely result in a gene list containing a number of false-positives. However, our analysis of the microarray data involved identification of differentially expressed genes using a student t-test and the Benjamini-Hochberg method was applied to correct for false discovery rate. The 1.2-fold cut-off was therefore chosen to include a wide representative of genes whose expression was changed by the shRNA treatment. Thus our gene lists are likely to contain relatively few false-negatives at the expense of containing some false-positives.
As seen in the heat map in Figure 4, there are sets of genes that are either down-regulated or up-regulated in Cyclin T2 depletions, and different sets of genes that are down-regulated or up-regulated in Cyclin T1 depletions. The genes are arranged such that the up-regulated genes are at the top and the down-regulated genes at the bottom of the heat map. In addition, there are other sets of genes that are down-regulated or up-regulated in both Cyclin T2 and Cyclin T1 depletions.
Figure 4. Differential expression of genes following Cyclin T2 or Cyclin T1 knockdown. Heat map of genes differentially expressed in HeLa cells infected with lentiviral
shRNA vectors against Cyclin T2 or Cyclin T1 compared to control MM. Up regulated
genes are in red and down regulated genes are in green. The insets represent an enlargement
of a portion of the heat map.
As shown in the Venn diagram in Figure 5, 292 total genes were down-regulated >1.2-fold when Cyclin T2 was depleted and 631 total genes were down-regulated >1.2-fold when Cyclin T1 was depleted. A total of 111 genes were up-regulated >1.2-fold in Cyclin T2 depletions and a total of 287 genes were up-regulated >1.2-fold in Cyclin T1 depletions (Figure 5B). The intersection of Cyclin T2 and Cyclin T1 down-regulated genes contains 100 total common genes, while the intersection of up-regulated genes contains 45 common genes.
Figure 5. Summary of pairwise comparisons for genes affected in shRNA T2 and shRNA T1 infected
HeLa cells. The Venn diagram represents the following individual pairwise comparisons: down
regulated genes- shRNA T2 (blue circle) vs. shRNA T1 (orange circle), up regulated
genes- shRNA T2 (purple circle) vs. shRNA T1 (green circle) each compared to shRNA
MM. Number in parentheses represents the total number of genes whose expression was
changed for that comparison. The numbers within each circle represents the genes unique
to that comparison. The number in the intersection of the gene sets representing the
shared genes whose expression was changed is indicated.
Redundant and non-redundant regulation of genes by Cyclin T2 or Cyclin T1 in HeLa cells
As expected, we identified genes that were up- or down-regulated by depletion of Cyclin T2 and Cyclin T1 (Figures 4, 5, 6). However, we were interested in characterizing the genes whose expression was down-regulated by the depletions, as these are more likely to be directly regulated by Cyclin T2 or Cyclin T1. The 10 genes showing the most down-regulation upon Cyclin T2 or Cyclin T1 depletion are shown in Table 1. Genes that were down-regulated only in Cyclin T2 depletions included Heat shock protein 3, HEXIM1 and Ankyrin repeat domain 12, while genes that were down-regulated only in Cyclin T1 depletions included Ankyrin repeat domain 29 and serine threonine kinase 38 (Table 1). Genes that were down-regulated in both Cyclin T2 and Cyclin T1 depletions include Forkhead box Q1 and Dual specificity phosphatase 16 (Table 2) indicating that genes important in immune response are under redundant control of both Cyclin T2 and T1.
Figure 6. KEGG pathway analysis of genes regulated by Cyclin T2 and Cyclin T1. KEGG pathway grouping was done based on z-score following Gene Ontologic analysis
of the unique and shared gene sets down regulated following HeLa cell infection with
shRNA T2 or shRNA T1 lentiviral vectors compared to cells infected with control shRNA
MM vector. The pie charts show over represented pathways for indicated conditions.
The z-scores are also presented.
Table 1. List of genes down regulated upon Cyclin T2 and Cyclin T1 depletion
Table 2. List of genes commonly down regulated by Cyclin T2 or Cyclin T1 depletion
Gene Ontology and KEGG pathway analyses were carried out on the gene lists based on z-scores. The z-score is based on hypergeometric distribution and is calculated from the total number of genes in the array, the number of genes on the specific pathway, the number of genes on the gene list. Thus, a z-score of 0 indicates no enrichment, i.e., the expected number of hits is observed. A positive z-score indicates enrichment and a negative z score indicates under-representation.
Gene Ontology grouping showed that genes down-regulated by Cyclin T2 depletion included genes involved in response to stimulus and stress, negative regulation of metabolism and transcription, signal transduction and muscle development (Table 3). Genes down-regulated by Cyclin T1 depletion included genes involved in metabolism, intracellular signalling cascade, regulation of apoptosis, cell growth, transport, regulation of DNA repair, and antigen processing and presentation (Table 3). Genes commonly down-regulated by either Cyclin T2 or T1 depletion included genes involved in cellular processes, apoptosis, cell death, myeloid cell differentiation and lymphoid organ development (Table 3).
Table 3. Gene Ontology (GO) analysis of the gene list based on z-score
The gene list was also analyzed and grouped based on KEGG pathways (Figure 6). Genes affected by Cyclin T2 depletion were over-represented in signalling pathways (specifically MAPK, GnRH, and insulin signalling) and vesicular transport, while genes affected by Cyclin T1 depletion included genes involved in metabolism (lipid and inositol phosphate) and biosynthesis (diterpenoid and streptomycin). Interestingly, genes involved in MAPK and GnRH signalling pathways were over-represented in both Cyclin T2 and T1 depletions. While the over-represented pathways are similar, the identity of the genes are different suggesting that there is a limited degree of redundancy in the genes regulated by Cyclin T2 and Cyclin T1 even though there is a set of genes under specific control of either Cyclin T.
Dysregulation of specific genes could be a predisposition for development of a diseased state and because P-TEFb is responsible for transcriptional elongation of most protein coding genes [34], we next looked at the potential link between our gene list and diseases using the disease-gene link in DAVID http://david.abcc.ncifcrf.gov webcite. As expected, the Cyclin T1 specific gene-list was over-represented for genes involved in HIV-1 infection. The other diseases implicated include dementia, cancers (colorectal and bladder), age related macular degeneration, cholesterol/LDL related and gallstones (Table 4). Cyclin T2 specific genes were over represented only in the aging process while metabolic and cardiovascular diseases were linked to genes that were commonly down-regulated upon Cyclin T2 or Cyclin T1 depletion (Table 4).
Table 4. Functional annotation of genes associated with disease
Discussion
In this study, we employed shRNA lentiviral vectors and cDNA microarrays to profile changes in mRNA expression levels in HeLa cells in response to long term depletion of the P-TEFb regulatory subunits Cyclin T2 and Cyclin T1. Using a 1.2-fold cut-off, we found that 292 and 631 genes were down-regulated upon depletion of Cyclin T2 and Cyclin T1, respectively. On the other hand, 111 and 287 genes were up-regulated upon depletion of Cyclin T2 or Cyclin T1, respectively. Interestingly, expression of 100 and 45 genes were commonly down-regulated or up-regulated, respectively, when either Cyclin was depleted. These data indicate that there is limited redundancy in the genes regulated in HeLa cells by either of the Cyclin partners of Cdk9 in P-TEFb complexes.
P-TEFb is required for the transcriptional elongation of most protein coding genes in mammals [34]. The P-TEFb complex containing Cyclin T1 has been examined in detail because it is an essential host factor in HIV-1 gene expression. However, Cyclin T2 has been reported to play a role in myocyte differentiation [35,36]. In this study, we found that depletion of either Cyclin T2 or Cyclin T1 under our conditions did not significantly affect cell growth or viability in HeLa cells. Thus, it is likely that a certain degree of redundancy is built into the genes regulated in transformed cells by either Cyclin T1and Cyclin T2. A recent report found that a Cyclin T2 knock-out resulted in embryonic lethality in mice [27]. In the same study, it was also reported that Cyclin T2 and T1 serve mostly redundant but also some non-redundant functions in murine ES cells [27]. In C.elegans, ablation of either Cyclin T2 or Cyclin T1 had no deleterious effect, indicating a high degree of redundancy in the functions of the Cyclins, although depletion of both Cyclins resulted in embryonic lethality [37]. Thus, there appears to be a degree of redundancy in the role of Cyclin T2 and T1 across species.
The expression of Cyclin T2 and T1 varies in primary hematopoietic cells. While Cyclin T2 is constitutively expressed in resting CD4+ T-cells and monocytes, Cyclin T1 expression is very low in these cells [8,12]. Activation of CD4+ T-cells and differentiation of monocytes into macrophages up-regulates Cyclin T1 levels by post-transcriptional mechanisms while Cyclin T2 level remains relatively constant [8,10,12,38,39]. We speculate that the expression pattern of both Cyclins reflect the nature of the genes that they regulate in these cells. We found that genes involved in metabolism (inositol phosphate and glycosphinglipid), biosysnthesis (Diterpenoid), and degradation (phenolics) were down-regulated upon Cyclin T1 and not Cyclin T2 depletion, whereas Kohoutek et al. [27] report that genes involved in cell cycle and communication were down-regulated. When Cyclin T2 was depleted, genes of signaling pathways (MAPK, GnRH and Insulin) and vesicular transport were down-regulated, while the Kohoutek study [27] found that the mRNAs of Notch, Wnt and TGFβ signaling and autophagy-related genes were affected. These differences in the signaling pathways whose expression specifically changes upon Cyclin T2 depletion is likely due to the different experimental system used-- the Kohoutek study used siRNA depletions in mouse ES cells, while we used shRNA depletions in HeLa cells [27]. We found that genes involved in signaling, cell junction, long term potentiation of nerve synapse and Huntington's disease were commonly down-regulated when either Cyclin was depleted. This suggests that Cyclin partners (both T2 and T1) of Cdk9 play a role in the nervous system and underscores the importance of P-TEFb in key cellular processes.
In most cell types examined so far, it appears that Cyclin T1 is the major regulatory subunit in P-TEFb complexes, while Cyclin T2a and T2b are minor regulatory subunits. This suggests that more genes are regulated by Cyclin T1 than T2. In agreement with this notion, we found that in HeLa cells there were 631 genes repressed by Cyclin T1 depletion, while 292 genes were repressed by Cyclin T2 depletion. In contrast, Kohoutek et al. found that in mouse ES cells, 59 and 76 genes were affected when either Cyclin T1 or Cyclin T2 were depleted, respectively [27]. We had reported earlier that Cyclin T1 depletion repressed 644 genes in PMA+ionomycin activated Jurkat cells, 965 genes in PMA-treated MM6 monocytic cells, and 778 genes repressed in LPS- treated MM6 cells [14]. It therefore appears that more genes are under the control of Cyclin T1 than Cyclin T2, with the exception of mouse ES cells and perhaps other select primary cell types. While P-TEFb is involved in expression of most protein coding genes, the number of genes affected by the depletion of Cyclin T2 or Cyclin T1 in our and the Kohoutek et al. study [27] is not very high. We speculate that there could be a subset of genes having a low threshold requirement for functional P-TEFb which are not affected by the reduction in Cyclin T2 or Cyclin T1 expression following shRNA depletions. These genes may be affected if Cyclin T2 or Cyclin T1 is genetically ablated. It is also possible that a certain degree of redundancy exists for genes regulated by Cyclin T2 and Cyclin T1 as was seen here and by Kohoutek et al.[27]. In addition to Cyclin T2 and Cyclin T1, Cdk9 has been reported to associate with Cyclin K [40,41]. While we have not examined the role of Cyclin K in this study, it is possible that when Cyclin T2 or Cyclin T1 is depleted, the Cdk9-CyclinK complex might provide an additional level of redundancy to the regulation of genes by P-TEFb.
In our study, genes involved in negative regulation of transcription and metabolism were down-regulated upon Cyclin T2 depletion, while genes involved in cell growth, metabolism, apoptosis, cellular morphogenesis and signaling were down-regulated upon Cyclin T1 depletion. Genes that were commonly down-regulated when either Cyclin T2 or T1 was depleted included the Gene Ontologic class of positive and negative regulation of cellular processes, apoptosis, negative regulation of cell proliferation and innate immune response. It is possible that the classes of genes affected by inhibition of Cdk9 [42] and those found in our study are involved in a cross-talk depending on the cell type and the transcriptional requirement in response to environmental signals, although more work is required to establish this link.
As discussed above, expression of Cyclin T2 is constitutive while Cyclin T1 protein expression is inducible depending on the activation or differentiation status of primary T-cells and macrophages, respectively [8,12]. In the present study, the number of genes down-regulated when Cyclin T1 is depleted is much more (631) than those down-regulated when Cyclin T2 is depleted (292). This could be representative of the transcriptional requirements of the cell. When the cells are in resting or undifferentiated stage, the transcriptional program and metabolism needs to be regulated to maintain homeostasis and this may be reflected in the nature of the genes down-regulated upon Cyclin T2 depletion which include negative regulation of metabolism and transcription. The relevance of constitutive expression of Cyclin T2 is also underscored in the regulation of kinase activity, signal transduction, energy reserve metabolism. Once the cells are activated or undergo a program of differentiation, the regulation of genes probably shifts to those under control of Cyclin T1. As the transcriptional and metabolic needs of the cells increase in response to activation or differentiation signals, the nature of the genes controlled by Cyclins change to active cellular metabolism, nucleic acid metabolism, apoptosis and cell growth. In this context, our results are in agreement with those of Kohoutek et al. [27] as they found that depletion of Cyclin T2 and not Cyclin T1 affected genes important for early embryogenesis while genes involved in cell communication was repressed when Cyclin T1 and not Cyclin T2 was depleted. We found that the number of genes affected by depletion of Cyclin T2 is lower than those affected by Cyclin T1 depletion. It is likely that the importance of multiple P-TEFb complexes in a cell lies probably not just in the number but the identity and function of the regulated genes. For instance, we found that Ankyrin repeat domain 12 was down-regulated when Cyclin T2 and not Cyclin T1 was depleted, while Ankyrin repeat domain 29 was repressed when Cyclin T1 and not Cyclin T2 was depleted. Ankyrin repeat domains mediate protein-protein interactions and are observed in bacterial and eukaryotic proteins [33,34]. In particular Ankyrin repeat domains have been reported to be present in IκB proteins and mediate interaction with NF-κB [35]. These domains are involved in important biological functions like transcriptional regulation, cell cycle and differentiation [36]. As discussed above, we note that there are both similarities and differences between the Kohoutek et al.[27] study in ES cells and our study in HeLa cells with respect to genes regulated by Cyclin T2 and Cyclin T1. It is likely that the differences arise because of experimental approaches. Despite these differences, the data presented in our study and by Kohoutek and colleagues should prove useful for researchers to mine for studies of specific genes or pathways of interest.
In summary, we have carried out transcriptional profiling to gain an insight into the genes regulated by the two distinct regulatory subunits of P-TEFb, Cyclin T2 and Cyclin T1. We found that there is limited redundancy in the genes under control of either Cyclins. The identity of the genes regulated by Cyclin T2 and T1 and the expression patterns of the Cyclin proteins are consistent with the notion that Cyclin T2 plays an important role in regulating genes involved in quiescent cells, while Cyclin T1 plays an important role in regulating genes in metabolically active cells.
Methods
Cell culture, Cell extracts and immunoblots
HeLa cells were purchased from American Type Culture Collection (ATCC) and were maintained in DMEM (Invitrogen) with 10% FBS, 100 units of penicillin, and 100 μg/ml streptomycin. Cell extracts were prepared by incubating cells in lysis buffer (50 mM Tris, 120 mM NaCl, 0.5% NP-40) containing protease inhibitors (2 μg/ml aprotinin, 1 μg/ml leupeptin, 2.5 mM phenylmethylsulfonyl fluoride) as described previously [11]. Protein concentrations were determined by a Bio-Rad protein assay, and 20 μg of total protein was loaded onto 10% SDS-PAGE gels. The procedure for immunoblots using enhanced chemiluminescence for detection has been previously described [43]. Antibody to β- actin was purchased from Sigma, and other antibodies were purchased from Santa Cruz Biotechnology.
ShRNA design, Lentiviral production and Flow Cytometry
The target short hairpin RNA (shRNA) sequences used in this study were: shRNA CycT1: GCAGCGTCTTAACGTCTCA; shRNA -Cyc T2, GCCAGTACCTCTAA; shRNA -Control (MM), GCTATAGCTGTTCTAGTTC. The subcloning protocol into the FG12 self-inactivated lentiviral vector that carries an eGFP expression cassette has been described before [10]. The FG12 vector does not encode any viral gene products [44]. Briefly, oligonucleotides containing the target sequences with restriction enzyme site compatible overhangs were annealed and inserted into a hU6-1 plasmid vector immediately after the human U6 promoter. The shRNA expressing cassette was then subcloned into the FG12 vector. Stocks of the FG12 lentiviral vectors pseudotyped with vesicular stomatitis virus (VSV)-G were produced by either calcium phosphate mediated or Lipofectamine 2000 (Invitrogen) transient transfection of HEK-293T cells. Briefly, HEK-293T cells were cultured in 100-mm dishes in DMEM (Invitrogen) containing 10% FBS (Invitrogen), 100 units of penicillin, and 100 μg/ml streptomycin. The cells were cotransfected with 5 μg of each plasmid: vector plasmid, the VSV-G expression plasmid pHCMV-G, and the HIV-1 lentiviral packaging plasmids pRSV/REV and pMDLg/pRRE. Media was changed the following day and supernatants were passed through a 0.45-μm pore size sterile filter 48 hours post-transfection. Viral supernatants not used immediately were stored in aliquots at -80°C. HeLa cells were transduced at a multiplicity of infection (m.o.i.) of five in the presence of 5 ng/ml polybrene (Sigma). Transduction efficiencies were determined five days after lentiviral infection by suspending cells at 1 × 106 cells/ml in phosphate-buffered saline (PBS) with 2% FBS and the percentage of GFP positive cells were determined by flow cytometry using a Beckman-Coulter XL-MCL cytometer.
MTT cell viability assay
HeLa cells transduced with lentiviral shRNA vectors against Cyclin T1, Cyclin T2 and Control (MM) were sorted for GFP expression using a flow cytometer. One hundred thousand sorted cells were plated and at different time points MTT was added at 5 mg/mL. After an incubation of 4 h, the formazon product was dissolved in acidified isopropanol and color estimated at 560 nm.
Microarray analysis
HeLa cells were transduced with shRNA lentiviral vectors against Cyclin T2, Cyclin T1 or MM control as described above. Two independent biological replicate experiments were carried out. The cells were harvested five days post-transduction and total RNA for microarray analysis was extracted using Qiagen RNeasy Kit according to manufacturer's protocol and RNA quality was determined using an Aligent 2100 Bioanalyzer and the Nano-Drop ND-1000 Spectorphotometer. The RNA was reverse transcribed and the resultant cDNA transcribed using T7 RNA polymerase and biotinylated ribonucleotides to generate labeled cRNA. Fragmented cRNA was hybridized to U133 plus 2.0 human gene chips (Affymetrix) containing nearly 55,000 probe sets representing over 18,953 transcripts. Following washing and staining, the arrays were scanned using an Affymterix Gene Chip Scanner 3000, normalized to the medium intensity and analyzed. The primary microarray data have been deposited in the NCBI GEO database and are accessible through GEO Series accession number, GSE28339http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28339 webcite. The microarray data was analyzed using the GeneSifter microarray data analysis system (VizX Labs LLC, Seattle, WA; http://www.genesifter.net webcite). The program identifies differentially expressed genes and establishes the biological significance based on Gene Ontology (GO) http://www.geneontology.org webcite and KEGG pathways http://www.genome.jp/kegg/pathway.html webcite. The CEL files for each array were uploaded into GeneSifter and the data was normalized and log transformed using the GC-RMA algorithm. GC-RMA is the modified version of RMA (robust multi-array average) that uses probe sequence information for the background correction [45]. Differentially expressed genes were identified using Student t-test and a threshold of 1.2 was used to limit the data set to genes. Correction for multiple testing was performed using the Benjamini-Hochberg method to correct for false discovery rate.
The biological process ontologies and KEGG pathway terms associated with the differentially expressed genes were examined using a z-score report. The z-score report identifies ontologies or pathway terms that are significantly over-represented in a gene list [46]. Thus, a positive z-score indicates that more genes than expected beyond random chance fulfil the criteria (fold change and statistical criteria) in a certain group or pathway suggesting changes in that group or pathway. A negative z-score indicates that there were fewer genes than expected beyond random chance that met the fold change and statistic criteria. A functional annotation analysis was performed using DAVID http://david.abcc.ncifcrf.gov webcite[47,48] to identify the link between diseases and the gen lists.
Real-time PCR analysis
Microarray data were validated by quantitative real-time RT-PCR using the Bio-Rad MyIQ single color detection system as previously described [14]. Briefly, 1 μg of cellular RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad). Quantitative real-time PCR was performed using the iQ SYBR Green Supermix (Bio-Rad) in the Bio-Rad iCycler. Primers for quantitative PCR were designed Beacon Designer 2.0 (Premier Biosoft). Primers used were: Cyclin T2 (forward) GGCGGAGGAGGAAGTGTCATG, Cyclin T2 (reverse) GCGGCTCGGCGTGTTCTC; Cyclin T1 (forward) AACCTTCGCCGCTGCCTTC, Cyclin T1 (reverse) ACCGTTTGTTGTTGTTCTTCCTCTC, HEXIM1 (forward) GCAGTTGGAAGTTGGCAGGTG, HEXIM1 (reverse) TCAGTTCTCCTCCGCCTCCTC; OAS1 (forward) GAGCCTCATCCGCCTAGTCAAG, OAS1 (reverse) CCCAAGCATAGACCGTCAGGAG; MFAP5 (forward) CCTGGCTTTCTTGCTCTCCCTC, MFAP5 (reverse) CGAGTCCTTTGGCTGCTGAATG; CDKN1C (forward) CGGACGAGACAGGCGAACC, CDKN1C (reverse) GCGGCGGCTACCTGACTG; CRM1 (forward) CCACCTTGATTCGTCCCCTCTC, CRM1 (reverse) ACCAACTGCTCCTTCCTTCCTC; GAPDH (forward) CGCCAGCCGAGCCACATC, (reverse) AATCCGTTGACTCCGACCTTCAC; β-Actin (forward) AGCAAGCAGGAGTATGACGAGTC, β-Actin (reverse) AGAAAGGGTGTAACGCAACTAAGTC. Analysis was performed using the MyIQ software program (Bio-Rad) and the fold changes were calculated using either β-Actin or GAPDH as a reference control as described earlier [49].
List of abbreviations
RNAP II: RNA polymerase II; Cdk9: Cyclin dependent kinase 9; NELF: Negative elongation factor; DSIF: 5, 6-dichloro-1-β-D-ribofuranosylbenzimidazole; HEXIM1: hexamethylene bisacteamide-inducible 1.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
R.R. carried out experiments, analyzed the data and wrote the manuscript. W.Y. constructed the shRNA vectors. A.P.R. conceived of the study and wrote the paper. All authors read and approved the final manuscript.
Authors' information
R.R. is a postdoctoral fellow and A.P.R. is Nancy Chang Professor in Department of Molecular Virology & Microbiology, Baylor College of Medicine, Houston, TX. W.Y. is currently a Resident in the Department of Pathology, University of Miami Miller School of Medicine.
Acknowledgements & Funding
The authors thank Dr. Dorothy E. Lewis, Baylor College of Medicine Flow Cytometry core for help with cell sorting, and Baylor College of Medicine Microarray core for DNA microarrays. This study was supported by NIH grants AI35381 to A.P.R. and T32 AI7456 to R.R.
References
-
Peterlin BM, Price DH: Controlling the elongation phase of transcription with P-TEFb.
Mol Cell 2006, 23:297-305. PubMed Abstract | Publisher Full Text
-
Zhou Q, Yik JH: The Yin and Yang of P-TEFb regulation: implications for human immunodeficiency virus gene expression and global control of cell growth and differentiation.
Microbiol Mol Biol Rev 2006, 70:646-659. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Guenther MG, Levine SS, Boyer LA, Jaenisch R, Young RA: A chromatin landmark and transcription initiation at most promoters in human cells.
Cell 2007, 130:77-88. PubMed Abstract | Publisher Full Text
-
Hargreaves DC, Horng T, Medzhitov R: Control of inducible gene expression by signal-dependent transcriptional elongation.
Cell 2009, 138:129-145. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Michels AA, Bensaude O: RNA-driven cyclin-dependent kinase regulation: when CDK9/cyclin T subunits of P-TEFb meet their ribonucleoprotein partners.
Biotechnol J 2008, 3:1022-1032. PubMed Abstract | Publisher Full Text
-
Chen R, Yang Z, Zhou Q: Phosphorylated positive transcription elongation factor b (P-TEFb) is tagged for inhibition through association with 7SK snRNA.
J Biol Chem 2004, 279:4153-4160. PubMed Abstract | Publisher Full Text
-
Dow EC, Liu H, Rice AP: T-loop phosphorylated Cdk9 localizes to nuclear speckle domains which may serve as sites of active P-TEFb function and exchange between the Brd4 and 7SK/HEXIM1 regulatory complexes.
J Cell Physiol 2010, 224:84-93. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Liou LY, Haaland RE, Herrmann CH, Rice AP: Cyclin T1 but not cyclin T2a is induced by a post-transcriptional mechanism in PAMP-activated monocyte-derived macrophages.
J Leukoc Biol 2006, 79:388-396. PubMed Abstract | Publisher Full Text
-
Sung TL, Rice AP: miR-198 inhibits HIV-1 gene expression and replication in monocytes and its mechanism of action appears to involve repression of cyclin T1.
PLoS Pathog 2009, 5:e1000263. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Yu W, Wang Y, Shaw CA, Qin XF, Rice AP: Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs.
Retrovirology 2006, 3:32. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Herrmann CH, Carroll RG, Wei P, Jones KA, Rice AP: Tat-associated kinase, TAK, activity is regulated by distinct mechanisms in peripheral blood lymphocytes and promonocytic cell lines.
J Virol 1998, 72:9881-9888. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Sung TL, Rice AP: Effects of prostratin on Cyclin T1/P-TEFb function and the gene expression profile in primary resting CD4+ T cells.
Retrovirology 2006, 3:66. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Marshall RM, Salerno D, Garriga J, Grana X: Cyclin T1 expression is regulated by multiple signaling pathways and mechanisms during activation of human peripheral blood lymphocytes.
J Immunol 2005, 175:6402-6411. PubMed Abstract | Publisher Full Text
-
Yu W, Ramakrishnan R, Wang Y, Chiang K, Sung TL, Rice AP: Cyclin T1-dependent genes in activated CD4 T and macrophage cell lines appear enriched in HIV-1 co-factors.
PLoS ONE 2008, 3:e3146. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Biglione S, Byers SA, Price JP, Nguyen VT, Bensaude O, Price DH, Maury W: Inhibition of HIV-1 replication by P-TEFb inhibitors DRB, seliciclib and flavopiridol correlates with release of free P-TEFb from the large, inactive form of the complex.
Retrovirology 2007, 4:47. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Chao SH, Fujinaga K, Marion JE, Taube R, Sausville EA, Senderowicz AM, Peterlin BM, Price DH: Flavopiridol inhibits P-TEFb and blocks HIV-1 replication.
J Biol Chem 2000, 275:28345-28348. PubMed Abstract | Publisher Full Text
-
Chiu YL, Cao H, Jacque JM, Stevenson M, Rana TM: Inhibition of human immunodeficiency virus type 1 replication by RNA interference directed against human transcription elongation factor P-TEFb (CDK9/CyclinT1).
J Virol 2004, 78:2517-2529. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Flores O, Lee G, Kessler J, Miller M, Schlief W, Tomassini J, Hazuda D: Host-cell positive transcription elongation factor b kinase activity is essential and limiting for HIV type 1 replication.
Proc Natl Acad Sci USA 1999, 96:7208-7213. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Foskett SM, Ghose R, Tang DN, Lewis DE, Rice AP: Antiapoptotic function of Cdk9 (TAK/P-TEFb) in U937 promonocytic cells.
J Virol 2001, 75:1220-1228. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Heredia A, Davis C, Bamba D, Le N, Gwarzo MY, Sadowska M, Gallo RC, Redfield RR: Indirubin-3'-monoxime, a derivative of a Chinese antileukemia medicine, inhibits P-TEFb function and HIV-1 replication.
AIDS 2005, 19:2087-2095. PubMed Abstract | Publisher Full Text
-
Salerno D, Hasham MG, Marshall R, Garriga J, Tsygankov AY, Grana X: Direct inhibition of CDK9 blocks HIV-1 replication without preventing T-cell activation in primary human peripheral blood lymphocytes.
Gene 2007, 405:65-78. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Chen R, Keating MJ, Gandhi V, Plunkett W: Transcription inhibition by flavopiridol: mechanism of chronic lymphocytic leukemia cell death.
Blood 2005, 106:2513-2519. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Chen R, Wierda WG, Chubb S, Hawtin RE, Fox JA, Keating MJ, Gandhi V, Plunkett W: Mechanism of action of SNS-032, a novel cyclin-dependent kinase inhibitor, in chronic lymphocytic leukemia.
Blood 2009, 113:4637-4645. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Cho SJ, Lee SS, Kim YJ, Park BD, Choi JS, Liu L, Ham YM, Moon Kim B, Lee SK: Xylocydine, a novel Cdk inhibitor, is an effective inducer of apoptosis in hepatocellular carcinoma cells in vitro and in vivo.
Cancer Lett 2010, 287:196-206. PubMed Abstract | Publisher Full Text
-
Lapenna S, Giordano A: Cell cycle kinases as therapeutic targets for cancer.
Nat Rev Drug Discov 2009, 8:547-566. PubMed Abstract | Publisher Full Text
-
Liu H, Herrmann CH, Chiang K, Sung TL, Moon SH, Donehower LA, Rice AP: 55K isoform of CDK9 associates with Ku70 and is involved in DNA repair.
Biochem Biophys Res Commun 2010, 397:245-250. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Kohoutek J, Li Q, Blazek D, Luo Z, Jiang H, Peterlin BM: Cyclin T2 is essential for mouse embryogenesis.
Mol Cell Biol 2009, 29:3280-3285. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS, Khvorova A: Rational siRNA design for RNA interference.
Nat Biotechnol 2004, 22:326-330. PubMed Abstract | Publisher Full Text
-
Peng J, Zhu Y, Milton JT, Price DH: Identification of multiple cyclin subunits of human P-TEFb.
Genes Dev 1998, 12:755-762. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Yao B, Rakhade SN, Li Q, Ahmed S, Krauss R, Draghici S, Loeb JA: Accuracy of cDNA microarray methods to detect small gene expression changes induced by neuregulin on breast epithelial cells.
BMC Bioinformatics 2004, 5:99. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Yuen T, Wurmbach E, Pfeffer RL, Ebersole BJ, Sealfon SC: Accuracy and calibration of commercial oligonucleotide and custom cDNA microarrays.
Nucleic Acids Res 2002, 30:e48. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Bixler GV, Vanguilder HD, Brucklacher RM, Kimball SR, Bronson SK, Freeman WM: Chronic insulin treatment of diabetes does not fully normalize alterations in the retinal transcriptome.
BMC Med Genomics 2011, 4:40. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
VanGuilder HD, Bixler GV, Kutzler L, Brucklacher RM, Bronson SK, Kimball SR, Freeman WM: Multi-modal proteomic analysis of retinal protein expression alterations in a rat model of diabetic retinopathy.
PLoS One 2011, 6:e16271. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Chao SH, Price DH: Flavopiridol inactivates P-TEFb and blocks most RNA polymerase II transcription in vivo.
J Biol Chem 2001, 276:31793-31799. PubMed Abstract | Publisher Full Text
-
De Luca A, De Falco M, Baldi A, Paggi MG: Cyclin T: three forms for different roles in physiological and pathological functions.
J Cell Physiol 2003, 194:101-107. PubMed Abstract | Publisher Full Text
-
Giacinti C, Bagella L, Puri PL, Giordano A, Simone C: MyoD recruits the cdk9/cyclin T2 complex on myogenic-genes regulatory regions.
J Cell Physiol 2006, 206:807-813. PubMed Abstract | Publisher Full Text
-
Shim EY, Walker AK, Shi Y, Blackwell TK: CDK-9/cyclin T (P-TEFb) is required in two postinitiation pathways for transcription in the C. elegans embryo.
Genes Dev 2002, 16:2135-2146. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Liou LY, Herrmann CH, Rice AP: Transient induction of cyclin T1 during human macrophage differentiation regulates human immunodeficiency virus type 1 Tat transactivation function.
J Virol 2002, 76:10579-10587. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Rice AP, Herrmann CH: Regulation of TAK/P-TEFb in CD4+ T lymphocytes and macrophages.
Curr HIV Res 2003, 1:395-404. PubMed Abstract | Publisher Full Text
-
Lin X, Taube R, Fujinaga K, Peterlin BM: P-TEFb containing cyclin K and Cdk9 can activate transcription via RNA.
J Biol Chem 2002, 277:16873-16878. PubMed Abstract | Publisher Full Text
-
Yu DS, Cortez D: A role for cdk9-cyclin k in maintaining genome integrity.
Cell Cycle 2011, 10:28-32. PubMed Abstract | Publisher Full Text
-
Garriga J, Xie H, Obradovic Z, Grana X: Selective control of gene expression by CDK9 in human cells.
J Cell Physiol 2010, 222:200-208. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Yang X, Herrmann CH, Rice AP: The human immunodeficiency virus Tat proteins specifically associate with TAK in vivo and require the carboxyl-terminal domain of RNA polymerase II for function.
J Virol 1996, 70:4576-4584. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Qin XF, An DS, Chen IS, Baltimore D: Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5.
Proc Natl Acad Sci USA 2003, 100:183-188. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Qin LX, Beyer RP, Hudson FN, Linford NJ, Morris DE, Kerr KF: Evaluation of methods for oligonucleotide array data via quantitative real-time PCR.
BMC Bioinformatics 2006, 7:23. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Doniger SW, Salomonis N, Dahlquist KD, Vranizan K, Lawlor SC, Conklin BR: MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data.
Genome Biol 2003, 4:R7. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Dennis G, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA: DAVID: Database for Annotation, Visualization, and Integrated Discovery.
Genome Biol 2003, 4:P3. PubMed Abstract | BioMed Central Full Text
-
Huang da W, Sherman BT, Lempicki RA: Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources.
Nat Protoc 2009, 4:44-57. PubMed Abstract | Publisher Full Text
-
Haaland RE, Herrmann CH, Rice AP: siRNA depletion of 7SK snRNA induces apoptosis but does not affect expression of the HIV-1 LTR or P-TEFb-dependent cellular genes.
J Cell Physiol 2005, 205:463-470. PubMed Abstract | Publisher Full Text