Table 2

Primer information of reference genes for qRT-PCR

Sprague-Dawley rat

New Zealand White Rabbit


Forward (5'-3')

Reverse (5'-3')

Product size (bp) [Ref]

Forward (5'-3')

Reverse (5'-3')

Product size (bp) [Ref]


Actb

AGGCCAACCGTGAAAAGATG

ACCAGAGGCATACAGGGACAA

101 [33]

CTGGAACGGTGAAGGTGACA CGGCCACATTGCAGAACTTT

73 [D]

GAPDH

GCAAGAGAGAGGCCCTCAG

TGTGAGGGAGATGCTCAGTG

74 [18]

GGGTGGTGGACCTCATGGT

CGGTGGTTTGAGGGCTCTTA

58 [D]

18S rRNA

ACGGACCAGAGCGAAAGCAT

TGTCAATCCTGTCCGTGTCC

310 [19]

TCGGCATTCGAACGTATGC

ACCCGTGGTCACCATGGTA

56 [D]

CycA

TATCTGCACTGCCAAGACTGAGTG

CTTCTTGCTGGTCTTGCCATTCC

126 [20]

CCAACGGCTCCCAGTTCTT

ACGTGCTTGCCGTCCAA

61 [D]

Hprt1

TGTTTGTGTCATCAGCGAAAGTG

ATTCAACTTGCCGCTGTCTTTTA

66 [D]

GCAGACCTTGCTTTCCTTGGT

GCAGGCTTGCGACCTTGAC

63 [D]

Ywhaz

TTGAGCAGAAGACGGAAGGT

GAAGCATTGGGGATCAAGAA

136 [19]

GGTCTGGCCCTTAACTTCTCTGTGTTCTA

GCGTGCTGTCTTTGTATGATTCTTCACTT

142 [28]

Pgk1

ATGCAAAGACTGGCCAAGCTAC

AGCCACAGCCTCAGCATATTTC

104 [20]

TGTTGGTCGGGCGAAGCAG

CAGTGTCTCCACCGCCGATG

149 [28]


[D] designed primer

Seol et al. BMC Research Notes 2011 4:162   doi:10.1186/1756-0500-4-162

Open Data