Table 1

Confirmation primers designed and directly re-amplified from HLB-infected samples.

Target region

Forward primers (5'-3')

Reverse Primers (5'-3')

Amplicon

size

(bp)


Region-1

Region-1-L-F GGTCAATTCAATGCGCTATAC

Region-1-L-R CAGGAATCTGTCGAGCAATGG

3,308

Region-1-R-F1 GGCATGTGTTGGTCTTGGAA

Region-1-R-R1 TCGGTGATTCAATAATTTCC

3,019

Region-1-R-F 2 CTCAATGGTGGCAGTTCGCTG

Region-1-R-R2 TTCTTTCCCAAGACCAACACATGC

398

RpoB Las primer

RpoB-las-F AATTTTTCTGTTCCTCGCAGC

RpoB-las-R CAGCGAACTGCCACCATTGAG

1,530

RpoB Las & Laf common primer pair

RpoB-las-laf-F TCAACTTGAAGAACATGTGAACTCTCTTTCGC

RpoB-las-laf-R CAGCGAACTGCCACCATTGAG

1,508

Region-2

Region-2-L-F GCGGGCCTGTTGATAATCCTGC

Region-2-L-R CACATAACCAAGTCAACCCA

1,931

Region-2-R-F CAACAACCCTGACCTCCATC

Region-2-R-R CACAGTTTCATAGCCTCCCA

1,041

Region-3

Region-3-L-F GCAGCTGGAAGGGGATTCAC

Region-3-L-R GATAGCACCCTGATATTACACAA

4,150

Region-3-R-F GAGGAACCGTTGAGTATGGC

Region-3-R-R TTTCTACAGTCTACGATGCG

1,124


Primers were designed based on the DNA sequences obtained by a genomic walking protocol. Amplification parameters are detailed in the Methods section.

Doddapaneni et al. BMC Research Notes 2008 1:72   doi:10.1186/1756-0500-1-72

Open Data