Short Report
Vitamin K epoxide reductase complex subunit 1 (Vkorc1) haplotype diversity in mouse priority strains
-
* Corresponding author: Michael H Kohn hmkohn@rice.edu
1 Department of Ecology and Evolutionary Biology, Institute of Biotechnology & Bioengineering, Rice University, MS 170 205A Anderson Biology Lab 6100 Main Street, Houston, Texas 77005, USA
2 University of Texas Southwest medical center, Dallas, Texas 75390, USA
BMC Research Notes 2008, 1:125 doi:10.1186/1756-0500-1-125
Published: 1 December 2008Additional files
Additional file 1:
List of haplotypes inferred from 237 polymorphisms for 40 mouse priority strains. To be consistent with the Vkorc1 direction in the mouse genome, the polymorphisms (5'→3') start from right to left. Question marks and the blank indicate the gaps and missing data, respectively. Locations of polymorphisms in the mouse Vkorc1 reference sequence (Ensembl No. ENSMUSG00000030804) are shown on the top. SNPs identifiers (rs number) are shown for the published SNPs. Five non-synonymous polymorphisms are indicated with Arg12Trp, Ala21Thr, Ala26Ser, Ala48Thr and Arg61Leu, and four synonymous polymorphisms are indicated with Leu10Leu, Glu37Glu, Arg53Arg, and Cys132Cys. Negative numbers indicate the locations of the polymorphisms in the 5' flanking region. Seven multiple-base indels are replaced by E (ATGCCTTTGATCCCAGCACTTCTGAGGCAGAAGCAGGCAAAGCTCTGAGTTCAAGGCCAGCCTGGTCT), Z (ACACAGTTC), X (CTGTAAAGCTACTATTAACAGGACGGTA), L (ACACA), O(ATTGGGT), P (CAGCCCC), and Q (AGA). Color coding of SNPs as employed by the Mouse Phenome Database SNP reports http://phenome.jax.org/ webcite.
Format: XLS Size: 95KB Download file
This file can be viewed with: Microsoft Excel Viewer
Additional file 2:
Dendrogram for 40 mouse priority strains with haplotypes 1–10 (haplotype identifiers in parentheses) based on the prothrombin time (PT) and bone mineralization (BMD/C) values. Haplotypes different from those found in most of the commonly used strains are labeled in red.
Format: PDF Size: 448KB Download file
This file can be viewed with: Adobe Acrobat Reader