Email updates

Keep up to date with the latest news and content from BMC Medical Genomics and BioMed Central.

Open Access Research article

Polymorphism in glutamate cysteine ligase catalytic subunit (GCLC) is associated with sulfamethoxazole-induced hypersensitivity in HIV/AIDS patients

Danxin Wang1*, Amanda Curtis1, Audrey C Papp1, Susan L Koletar2 and Michael F Para2

Author Affiliations

1 Department of Pharmacology, Program in Pharmacogenomics, School of Biomedical Science, College of Medicine, Ohio State University, Columbus, OH, 43210, USA

2 Division of Infectious Diseases, Internal Medicine, College of Medicine, Ohio State University, Columbus, OH, 43210, USA

For all author emails, please log on.

BMC Medical Genomics 2012, 5:32  doi:10.1186/1755-8794-5-32

The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1755-8794/5/32


Received:14 May 2012
Accepted:23 July 2012
Published:23 July 2012

© 2012 Wang et al.; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Sulfamethoxazole (SMX) is a commonly used antibiotic for prevention of infectious diseases associated with HIV/AIDS and immune-compromised states. SMX-induced hypersensitivity is an idiosyncratic cutaneous drug reaction with genetic components. Here, we tested association of candidate genes involved in SMX bioactivation and antioxidant defense with SMX-induced hypersensitivity.

Results

Seventy seven single nucleotide polymorphisms (SNPs) from 14 candidate genes were genotyped and assessed for association with SMX-induced hypersensitivity, in a cohort of 171 HIV/AIDS patients. SNP rs761142 T > G, in glutamate cysteine ligase catalytic subunit (GCLC), was significantly associated with SMX-induced hypersensitivity, with an adjusted p value of 0.045. This result was replicated in a second cohort of 249 patients (p = 0.025). In the combined cohort, heterozygous and homozygous carriers of the minor G allele were at increased risk of developing hypersensitivity (GT vs TT, odds ratio = 2.2, 95% CL 1.4-3.7, p = 0.0014; GG vs TT, odds ratio = 3.3, 95% CL 1.6 – 6.8, p = 0.0010). Each minor allele copy increased risk of developing hypersensitivity 1.9 fold (95% CL 1.4 – 2.6, p = 0.00012). Moreover, in 91 human livers and 84 B-lymphocytes samples, SNP rs761142 homozygous G allele carriers expressed significantly less GCLC mRNA than homozygous TT carriers (p < 0.05).

Conclusions

rs761142 in GCLC was found to be associated with reduced GCLC mRNA expression and with SMX-induced hypersensitivity in HIV/AIDS patients. Catalyzing a critical step in glutathione biosynthesis, GCLC may play a broad role in idiosyncratic drug reactions.

Keywords:
Idiosyncratic drug reaction; Sulfamethoxazole; Hypersensitivity; Glutamate cysteine ligase catalytic subunit (GCLC); Association; HIV/AIDS

Background

Sulfamethoxazole (trimethoprim-sulfamethoxazole, TMP-SMX, cotrimoxazole) is a commonly used antibiotic against opportunistic infections associated with HIV/AIDS or other immuno-compromised states, including organ transplantation and cancer chemotherapy [1,2]. SMX-induced hypersensitivity, characterized by fever, skin rash, lymphadenopathy, and multiple organ toxicity [2], is considered an idiosyncratic adverse drug reaction with uncertain mechanisms. Such idiosyncratic adverse drug reactions common to numerous drugs (e.g., isoniazid, carbamazepine, phenytoin, abacavir, etc) are considered to be multifactorial and multigenic. Individual susceptibility appears to be determined by both genetic predisposition and environmental factors [3-5]. At least three distinct processes contribute: (1) production of reactive metabolites via drug metabolism/bioactivation; (2) reactive oxygen species (ROS) processing, and (3) binding of reactive metabolites to proteins/DNA, resulting in inflammation, cell damage, neo-antigen formation, and immune response. Polymorphisms in genes involved in all these processes may modify risk of developing idiosyncratic drug reactions.

SMX is predominantly inactivated through N-acetylation by two polymorphic enzymes, N-acetyltransferase 1 (NAT1) and NAT2 [6,7](Figure 1). Alternatively, SMX can be activated by cytochrome P450s (mainly CYP2C9) in the liver, or by peroxidases (MPO) [8], flavin-containing monooxygenases (FMOs) [9], and prostaglandin-endoperoxide synthase (PTGSs) [10] in liver or target tissues, producing toxic N4-hydroxylamine-SMX (HA-SMX). HA-SMX can auto-oxidize via nitroxide-SMX to nitroso-SMX [11]. This highly reactive product [6,12] binds to cellular proteins, forming neo-antigens, and triggers human major histocompatibility complex (HMC) restricted T-cell mediated immune response [13]. Nitroso-SMX can be reduced by glutathione (GSH) into HA-SMX, then HA-SMX is reduced back to SMX by NADH-cytochrome b5/cytochrome b5 reductase. Therefore, GSH is the main cellular antioxidant, scavenging reactive metabolites and preventing tissue damage (Figure 1).

thumbnailFigure 1 . Pathways of SMX metabolism, bio-activation and detoxification, and pathway of GSH biosynthesis. NAT1/2, N-acetyltransferase 1 and 2; 2C9, cytochrome p450 2C9; MPO, myeloperoxidase; PTGS, prostaglandin-endoperoxide synthase; FMO, flavin containing monooxygenase; Cyb5R, NADH-cytochrome b5/cytochrome b5 reductase complex; GSH, glutathione; GCL, glutamate-cystein ligase, including catalytic and regulatory subunits GCLC and GCLM; GSS, glutathione synthetase.

Genetic association studies, including genome wide association studies, have identified genetic polymorphisms in HLA loci as strong risk factors for idiosyncratic drug reactions induced by abacavir [14], nevirapine [15], carbamazepine [16], allopurinol [17], lumiracoxib [18], flucloxacillin[19] and ximelagatran [20]. However, the involvement of HLA variants in SMX-induced hypersensitivity is unclear. Previously serological typing indicated an association between HLA-A30 B13 CW6 haplotype and SMX-induced skin toxicity [21]. Recently, one study has demonstrated weak association between HLA B*38 and SMX induced Stevens-Johnson syndrome [22], while another study failed to find association between SMX hypersensitivity and HLA-DRB1 (MHC class II) [23]. Although HLA polymorphisms appear to be the most penetrant risk factors for idiosyncratic adverse drug reactions in general, other genetic factors are likely to contribute as well, because 2% to 10% of HLA risk allele carriers do not develop idiosyncratic adverse drug reactions [19,20,24].

NAT2 slow acetylator genotype/phenotype was suggested to predispose to SMX hypersensitivity in non-HIV/AIDS individuals [25,26], while no such associations were observed in HIV/AIDS patients in several studies [27-29], possibly owing to reduced activities of liver drug metabolizing enzymes during HIV infection. Similarly, loss of function alleles *2 and *3 of CYP2C9 decrease bio-activation of SMX, potentially protecting against adverse effects [30]. However, these CYP2C9 alleles were not significantly associated with SMX hypersensitivity in HIV/AIDS patients [28]. Recently, we reported the gain of function alleles *10 and *11 in NAT1 to be protective against SMX-induced hypersensitivity in HIV/AIDS patients, but this was only observed in patients who are slow acetylators for NAT2[31], a rare example of a gene-gene-drug interaction.

We hypothesized that additional polymorphisms in genes involved in SMX bio-activation, reactive metabolite detoxification and GSH homeostasis could modify risk of SMX-induced hypersensitivity. To test this hypothesis, we genotyped 77 tagging SNPs selected from 14 candidate genes in a cohort of HIV/AIDS patients who were taking cotrimoxazole to prevent opportunistic infections. Our results indicate that a polymorphism in glutamate cysteine ligase catalytic subunit (GCLC), the rate limiting enzyme in GSH bio-synthesis, is significantly associated with SMX-induced hypersensitivity.

Results

Our study cohort comprises of a total of 420 HIV/AIDS patients who used cotrimoxazole (TMP-SMX) to prevent opportunistic infections, divided into two sub-cohorts according to time of enrollment (Table 1). Differences in age and distribution of sex between patients with hypersensitivity and patients without hypersensitivity were insignificant in cohort1 and the combined cohort, while small differences are present in cohort 2. Over 70% of patients were Caucasians, consistent with the HIV/AIDS population demographics in central Ohio in 1990s.

Table 1. Patient demographics

Seventy seven SNPs were successfully genotyped in samples from cohort 1 (Table 2) with call rates over 90%. The percentage of concordance is 98% for 10 duplicated samples. All SNPs followed the distribution of Hardy Weinberg’s Equilibrium with a p value >0.05. Single-SNP analysis showed 12 SNPs were significantly associated with SMX-induced hypersensitivity (basic allele test, p < 0.05) (Table 3), with a GCLC SNP scoring with the lowest p value (rs761142 T > G, p = 0.0006) (Figure 2). After adjusting for multiple comparisons using Bonferroni correction, rs761142 remained significant with p = 0.045.

Table 2. Successfully genotyped SNPs

Table 3. SNPs significantly associated with SMX-induced hypersensitivity (uncorrected p values)

thumbnailFigure 2 . Panel a. Association p value for SNPs in GCLCtested in this study. Panel b. Location of SNPs inGCLC. Panel c and d. LD plots for SNPs in GCLC in Caucasian (panel c) and African American (panel d) populations. The numbers represent LD R.2

To replicate this result, we genotyped rs761142 in DNA samples from cohort 2 and tested association with SMX-induced hypersensitivity. SNP rs761142 again showed significant association in the same direction with a p value of 0.025 (basic allele test). To further test the validity of the rs761142 association, we combining data from cohort 1 and cohort 2 and fitted the data into different genetics models. The data fitted best into an additive model, with odds ratio for TG vs TT being 2.2 (95% CL 1.4 – 3.7, p = 0.0014) and odds ratio for GG vs TT 3.3 (95% CL 1.6 – 6.8, p = 0.0010) (Table 4). Each copy of the minor G allele was associated with a 1.9 fold increase in risk (95% CL 1.4 – 2.6, p = 0.0001).

Table 4. Association between SNP rs761142 in GCLC and SMX-induced hypersensitivity

Two additional SNPs in GCLC were also significantly associated with SMX-induced hypersensitivity (Table 3, Figure 2), owing to their LD with rs761142. SNP rs670548 had been associated with GCLC expression in bronchial airway epithelial cells [32], but it did not reach significant association with SMX-induced hypersensitivity in cohort 1(Table 3 and Figure 2, P = 0.065). In the combined cohort, the association P value for rs670548 was 0.051. Because rs670548 is unevenly distributed in different populations and has very low allele frequency in African American population, we tested the association of rs670548 in Caucasians, where rs670548 was significantly associated with SMX-induced hypersensitivity (P = 0.025). However, rs761142 showed stronger association in the same cohort (P = 0.00015), indicating the association observed for rs670548 in Caucasians is a result of LD with rs761142 (D’ = 0.8 in Caucasian population, Figure 2). With the current study design (unmatched 1:3 case control ratio), and under the assumption of additive model with effect size of 2, we calculated the statistical power for cohort 1, cohort 2 and combined cohort to be 73%, 88% and 98%, respectively, to detect the effects of a polymorphism (for example rs761142) with minor allele frequency of 0.3 at α = 0.05.

Previous studies have indicated that promoter SNP rs17883901 and 5’UTR GAG trinucleotide repeats in GCLC are associated with schizophrenia and other diseases [33-35]. Genotyping these polymorphisms in cohort 1 showed that rs17883901 was not significantly associated with SMX-induced hypersensitivity (Additional file 1: Table S1). Similarly, none of GAG trinucleotide repeat variants showed significant associations (p = 0.32, chi-square test) (Additional file 1: Table S2). A previous study had proposed the less common genotypes (8/8, 9/9, 8/9, 7/8, ‘high risk alleles’) were associated with higher risk of developing schizophrenia compared to the more common repeats (7/7 and 7/9, ‘low risk alleles’) [35]. Moreover, red blood cells or peripheral blood mononuclear cells (PBMC) with 7/7 genotype showed changes in GCL activity and GSH levels compared to 9/9 or other genotypes [5,28]. However, we did not find an association between ‘high risk alleles’ in GCLC and SMX-induced hypersensitivity (Additional file 1: Table S1). Furthermore, promoter SNP rs17883901 and 5’UTR GAG trinucleotide repeat polymorphisms are not in linkage disequilibrium (LD) with rs761142 (Figure 2, LD D’ of 0.2 and 0.08, respectively). This result indicates that the association observed with rs761142 is unlikely to be caused by LD with previously identified promoter SNP rs17883901 or 5’UTR GAG trinucleotide repeat polymorphisms.

Additional file 1 . Table S1 and S2. Association between promoter SNP rs17883901 or 5’UTR GAG trinucleotide polymorphism in GCLC and SMX-induced hypersensitivity. Distribution of 5’UTR GAG trinucleotide repeats in patients with or without hypersensitivity. Chi-square test P=0.319.

Format: DOC Size: 39KB Download file

This file can be viewed with: Microsoft Word ViewerOpen Data

We next tested whether rs761142 affect GCLC mRNA expression in human livers and B-lymphocytes. The GCLC mRNA level was ~5% of β-actin mRNA in livers and 0.7% in B-lymphocytes. In 91 human livers and 84 B-lymphocytes, the average relative amounts of GCLG mRNA were 49 ± 5 and 7.0 ± 0.3 (mean ± SE), respectively, with considerable inter-person variability (40 fold in livers and 6 fold in B-lymphocytes). Figure 3 shows the relative GCLC mRNA levels grouped by rs761142 genotype in livers and B-lymphocytes. Samples with GG genotype showed less GCLC mRNA level than samples with TT genotype in both livers and B-lymphocytes (P < 0.05). This result indicates that the minor G allele of rs761142 is associated with reduced GCLC mRNA expression.

thumbnailFigure 3 . Relative level of GCLC mRNA in B-lymphocytes (a) and livers (b) grouped by rs761142 genotypes. *Compared to TT, p < 0.05 (t-test).

Discussion

In this study, we have found rs761142 T > G in GCLC to be significantly associated with SMX-induced hypersensitivity in HIV/AIDS patients, with each copy of the minor G allele increasing risk nearly 2 fold. Consistent with this finding, the rs761142 G allele was also significantly associated with reduced GCLC mRNA expression in livers and B-lymphocytes. In contrast, previously reported promoter SNP rs17883901 and 5’UTR GAG trinucleotide polymorphisms [33-35] did not show significant associations. Although reactive metabolites and oxidative stress were proposed to be involved in the pathogenesis of idiosyncratic drug reactions [4,5,36], this is the first study implicating a gene involved in antioxidant defense, affecting risk of idiosyncratic drug-induced cutaneous reactions.

Glutamate-cysteine ligase (GCL), a rate limiting enzyme for biosynthesis of glutathione (GSH) (Figure 1), is composed of a catalytic subunit (GCLC) and a modifier subunit (GCLM). GSH is the main cellular antioxidant, scavenging reactive metabolites and preventing tissue damage [11,37]. In HIV/AIDS patients, GSH levels are progressively depleted [38], consistent with the higher incidence of SMX-induced hypersensitivity in HIV/AIDS patients than in non-infected controls [39]. Moreover, SMX cytotoxicity is suppressed by addition of GSH in vitro [37], and cells with GCLC knockdown were more sensitive to reactive metabolites induced cytotoxicity [40]. Given the important role of GCLC in scavenging reactive metabolites, variants that reduce GCLC expression have a plausible role in increasing risk of developing SMX-induced hypersensitivity, especially in HIV/AIDS patients with already compromised GCLC function [38].

Previous GCLC studies have focused on promoter SNP rs17883901 and 5’UTR GAG trinucleotide polymorphisms [33-35]. Promoter SNP rs17883901 was shown to reduce basal and H2O2-induced promoter activity [33], while the GAG trinucleotide repeat variants affect GCLC protein expression through translation [41]. However, the reported results have been inconsistent. For example, the reference 7 repeat has been associated with either lower or higher GCL activity/GSH levels compared to variant repeats (4, 8, 9 or 10 repeats) in different cell types or disease conditions [35,41-43], indicating tissue/cell or environmental specific regulation of GCLC polymorphisms, or the presence of other unidentified functional polymorphisms in GCLC. This is consistent with numerous conflicting clinical association studies reported for GCLC[33-35,44-46]. Our study failed to reveal significant association between promoter SNP rs17883901 or 5’UTR GAG trinucleotide repeat polymorphisms and SMX-induced hypersensitivity. Instead, the significantly associated rs761142 is located in the middle of intron 1 of GCLC. Although intronic polymorphisms can affect gene expression by various mechanisms [47], there is no evidence that rs761142 is functional by itself; instead, the association observed in this study could be caused by other functional polymorphisms in LD with rs761142 responsible for lowering GCLC mRNA expression. Similarly, SNP rs670548, located in intron12 of GCLC and showing significant association in our study, had also been associated with GCLC mRNA expression previously [32]. Taken together, the results indicate that a regulatory polymorphism in GCLC that affects mRNA expression modify risk of developing SMX-induced hypersensitivity in HIV/AIDS patients. This result warrants replication in a larger cohort. Whether the GCLC polymorphisms are associated with SMX-induced hypersensitivity in non-HIV/AIDS patients will require further investigation.

There are several limitations in this observational clinical association study. First, the CD4 cell counts at the time of SMX administration were not uniformly available, therefore the influence from CD4 cell count cannot be evaluated; Second, patient comorbidity and co-medication information were not available. Since SMX is inactivated and bio-activated by drug metabolizing enzymes, other disease states or concomitant administration of other drugs may affect the balance between bio-activation and bio-inactivation of SMX, influencing the level of toxic metabolites. And finally, evaluation of rs670548 and risk of hypersensitivity in African American may be limited by small sample size. A prospective larger cohort study will needed in the future to fully evaluate the association between SNPs in GCLC and SMX-induced hypersensitivity.

We have previously reported the association between polymorphisms in NAT1 and NAT2 and SMX-induced hypersensitivity, and gene-gene interactions between NAT1 and NAT2[31]. Since idiosyncratic adverse drug reactions are thought to be multigenic, it is likely that the risks of developing hypersensitivity are modified by interactions between multiple genes. Before testing the interactions between NAT1/NAT2 and GCLC, it is important to identify the functional polymorphism(s) and assess the frequency, direction and effect size for each.

Although not reported for drug-induced idiosyncratic cutaneous reaction; previous studies have associated drug induced idiosyncratic liver injury to antioxidant defense genes (SOD2 and GPX1) [48]. Consistently, SOD2 knockout mice have increased sensitivity to idiosyncratic liver injury induced by troglitazone or acetaminophen [49]. Similarly, mice deficient in NFE2L2 (NRF2), a transcription factor regulating antioxidant genes expression, also have increased sensitivity to acetaminophen induced liver injury [50]. In the present study, we observed additional SNPs in antioxidant defense genes CATGSS and GPX3 to be associated with SMX-induced hypersensitivity at nominal p values less than 0.05 (Table 3). These results suggest that multiple polymorphisms in antioxidant defense genes may modify risk of developing idiosyncratic drug reaction in general.

Conclusions

We have identified a single nucleotide polymorphism in GCLC that was significantly associated with reduced GCLC mRNA expression and with SMX-induced hypersensitivity in HIV/AIDS patients. This study supports the role of reactive metabolites and oxidative stress in the pathogenesis of SMX-induced hypersensitivity. Since oxidative stress caused by xenobiotics capable of redox cycling is a common mechanism of idiosyncratic drug reactions, it is plausible that polymorphisms in GCLC or other antioxidant defense genes may also be associated with idiosyncratic drug reactions caused by other drugs.

Methods

Patient information

Subjects included in this study had consented to an IRB-approved protocol designed to collect clinical data and specimens on HIV-infected individuals evaluated for participation in clinical trials between 1993 to 1998 in the HIV Clinical Research Unit at The Ohio State University Medical Center. A total of 420 individuals with HIV/AIDS who were taking Cotrimoxazole (trimethoprim-sulfamethoxazole) for prophylaxis or treatment of opportunistic infections and who had complete clinical data and banked blood samples available were included. This cohort was divided into two sub-groups: cohort 1, 171 patients, enrolled during 1996 to 1998 when blood was drawn using acid citrate dextrose tubes; cohort 2, 249 patients, enrolled during 1993 to 1995 when blood was drawn using heparin tubes. Since heparin was found to interfere with the SNPlex genotyping reaction, only samples from cohort1 were subjected to SNPlex genotyping. Cohort 2 served as a replication cohort with genotyping performed using other methods as described below. SMX hypersensitivity was diagnosed by presence of at least two indicator adverse drug reactions, including skin rash, fever, pruritus, etc., that disappear after drug discontinuation [44].

Tissue samples

Human liver biopsy or autopsy samples were obtained from the Cooperative Human Tissue Network Midwestern and Western Division, under the approval of The Ohio State University Institutional Review Board. Epstein-Barr virus-transformed B-lymphocytes were obtained from Coriell Repositories. Preparation of genomics DNA, RNA and cDNA from tissues or cells was done as described [47].

Selection of genes and polymorphisms

We selected genes based on current literatures that are involved in SMX bio-activation, reactive oxygen species scavenging and GSH homeostasis (Table 2 and Figure 1). For each gene, we selected tagging SNPs from HapMap project using the criteria of: MAF >10%, R2 = 80% in Caucasian population (>70% of the patients are Caucasians). Sixteen genes were initially selected; two genes (MPO1 and G6PD) did not yield any SNPs that can be successfully genotyped using SNPlex genotyping method and were excluded.

SNPlex probe design and reagents

The select SNPs were submitted to Applied Biosystems (Foster City, California, USA) for the design of SNPlex panels following their proprietary selection algorithms. SNPlex panels and reagents were provided by Applied Biosystems as we have described previously [51].

SNPlex genotyping

SNPlex genotyping was carried out according to the manufacture’s protocol as described in [51].

Genomic DNA preparation

Preparation of genomic DNA from blood was performed as described [43,45].

Other genotyping methods

GCLC 5’UTR GAG trinucleotide polymorphism was genotyped by PCR using fluorescently labeled primers (FAM labeled forward primer: GGCTGAGTGTCCGTCTCG; reverse primer (unlabeled): GAACGTCCTTGTGCCGG) followed by capillary electrophoresis separation (ABI 3730 DNA analyzer, Applied Biosystems, Foster City, California, USA)) as described [52]. Promoter SNP rs17883901 was genotyped using PCR-based restriction fragment length polymorphism methods as described [33] with modification. Instead of running agarose gels to separate and visualize the products, we labeled forward primer with fluorescent dye (FAM), and separated fragments using ABI 3730 DNA analyzer after PCR amplification and restriction enzyme digestion. SNP rs761142 was genotyped using allele specific PCR (common forward primer: CAACAGTTGGTTCTAGCAAAAGGA; reverse primer for reference allele: CCACACTGCTGGCTCTCTTGTAA; reverse for variant allele: CCACACTGCTGGCTCTCTTGTAC) as described [47].

Quantitative mRNA analysis by real-time PCR

GCLC total mRNA levels in cDNA samples were determined by real-time PCR on an ABI 7500 sequence detection system with power SYBR Green PCR Master mix (life Technologoes). GCLC expression levels, in arbitrary units, were calculated by subtracting the β-actin cycle threshold (Ct) from the GCLC Ct to get ΔCt as described previously [47]. Arbitrary units for each sample = 1000*(2-ΔCt).

Data analysis

HelixTree 6.4.3 (Golden Helix, Bozeman, MT) was used to test for Hardy-Weinberg equilibrium and basic allele Chi-square test for association with SMX-induced hypersensitivity. The associations between genotypes and hypersensitivity were analyzed using logistic regression model performed using SAS 9.1.3 software (SAS Institute, Cary, NC). The suitability of model fitting was judged by deviance goodness of fit statistics p-value and score test p-value, both of which should be larger than 0.05. The differences between mRNA levels were tested by t-test using GraphPad Prism software (GraphPad Software, La Jolla, CA). Data are expressed as mean ± SE.

Abbreviations

SNP, Single nucleotide polymorphisms; GCLC, Glutamate cysteine ligase catalytic subunit; SMX, Sulfamethoxazole; LD, Linkage disequilibrium.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

DW designed the study, performed the experiments, analyzed the data and wrote the manuscript. MC and ACP designed and performed SNPlex genotyping experiments. SLK and MFP designed the clinical study. All authors read and approved the final manuscript.

Acknowledgements

We acknowledge Dr. Wolfgang Sadee for critical reading, editing and comments.

This study was supported by NIH Grant R21 AI074399 and U01 GM092655. This study was also partially supported by Award number UL1RR025755 from the National Center for Research Resources. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Center for Research Resources or the National Institutes of Health.

References

  1. Yazdanpanah Y, Losina E, Anglaret X, Goldie SJ, Walensky RP, Weinstein MC, Toure S, Smith HE, Kaplan JE, Freedberg KA: Clinical impact and cost-effectiveness of co-trimoxazole prophylaxis in patients with HIV/AIDS in Cote d'Ivoire: a trial-based analysis.

    Aids 2005, 19:1299-1308. PubMed Abstract | Publisher Full Text OpenURL

  2. Rodriguez M, Fishman JA: Prevention of infection due to Pneumocystis spp. in human immunodeficiency virus-negative immunocompromised patients.

    Clin Microbiol Rev 2004, 17:770-782.

    table of contents

    PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  3. Ju C, Uetrecht JP: Mechanism of idiosyncratic drug reactions: reactive metabolite formation, protein binding and the regulation of the immune system.

    Curr Drug Metab 2002, 3:367-377. PubMed Abstract | Publisher Full Text OpenURL

  4. Sanderson JP, Naisbitt DJ, Park BK: Role of bioactivation in drug-induced hypersensitivity reactions.

    Aaps J 2006, 8:E55-E64. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  5. Pirmohamed M: Genetic factors in the predisposition to drug-induced hypersensitivity reactions.

    Aaps J 2006, 8:E20-E26. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  6. Cribb AE, Spielberg SP, Griffin GP: N4-hydroxylation of sulfamethoxazole by cytochrome P450 of the cytochrome P4502C subfamily and reduction of sulfamethoxazole hydroxylamine in human and rat hepatic microsomes.

    Drug Metab Dispos 1995, 23:406-414. PubMed Abstract | Publisher Full Text OpenURL

  7. Winter HR, Unadkat JD: Identification of cytochrome P450 and arylamine N-acetyltransferase isoforms involved in sulfadiazine metabolism.

    Drug Metab Dispos 2005, 33:969-976. PubMed Abstract | Publisher Full Text OpenURL

  8. Cribb AE, Miller M, Tesoro A, Spielberg SP: Peroxidase-dependent oxidation of sulfonamides by monocytes and neutrophils from humans and dogs.

    Mol Pharmacol 1990, 38:744-751. PubMed Abstract | Publisher Full Text OpenURL

  9. Vyas PM, Roychowdhury S, Koukouritaki SB, Hines RN, Krueger SK, Williams DE, Nauseef WM, Svensson CK: Enzyme-mediated protein haptenation of dapsone and sulfamethoxazole in human keratinocytes: II. Expression and role of flavin-containing monooxygenases and peroxidases.

    J Pharmacol Exp Ther 2006, 319:497-505. PubMed Abstract | Publisher Full Text OpenURL

  10. Vogel C, Prostaglandin H: synthases and their importance in chemical toxicity.

    Curr Drug Metab 2000, 1:391-404. PubMed Abstract | Publisher Full Text OpenURL

  11. Cribb AE, Miller M, Leeder JS, Hill J, Spielberg SP: Reactions of the nitroso and hydroxylamine metabolites of sulfamethoxazole with reduced glutathione. Implications for idiosyncratic toxicity.

    Drug Metab Dispos 1991, 19:900-906. PubMed Abstract | Publisher Full Text OpenURL

  12. Nakamura H, Uetrecht J, Cribb AE, Miller MA, Zahid N, Hill J, Josephy PD, Grant DM, Spielberg SP: In vitro formation, disposition and toxicity of N-acetoxy-sulfamethoxazole, a potential mediator of sulfamethoxazole toxicity.

    J Pharmacol Exp Ther 1995, 274:1099-1104. PubMed Abstract | Publisher Full Text OpenURL

  13. Naisbitt DJ, Farrell J, Gordon SF, Maggs JL, Burkhart C, Pichler WJ, Pirmohamed M, Park BK: Covalent binding of the nitroso metabolite of sulfamethoxazole leads to toxicity and major histocompatibility complex-restricted antigen presentation.

    Mol Pharmacol 2002, 62:628-637. PubMed Abstract | Publisher Full Text OpenURL

  14. Mallal S, Nolan D, Witt C, Masel G, Martin AM, Moore C, Sayer D, Castley A, Mamotte C, Maxwell D, James I, Christiansen FT: Association between presence of HLA-B*5701, HLA-DR7, and HLA-DQ3 and hypersensitivity to HIV-1 reverse-transcriptase inhibitor abacavir.

    Lancet 2002, 359:727-732. PubMed Abstract | Publisher Full Text OpenURL

  15. Littera R, Carcassi C, Masala A, Piano P, Serra P, Ortu F, Corso N, Casula B, La Nasa G, Contu L, Manconi PE: HLA-dependent hypersensitivity to nevirapine in Sardinian HIV patients.

    Aids 2006, 20:1621-1626. PubMed Abstract | Publisher Full Text OpenURL

  16. Chung WH, Hung SI, Hong HS, Hsih MS, Yang LC, Ho HC, Wu JY, Chen YT: Medical genetics: a marker for Stevens-Johnson syndrome.

    Nature 2004, 428:486. PubMed Abstract | Publisher Full Text OpenURL

  17. Tseng YJ, Chu WC, Chung WY, Guo WY, Kao YH, Wang J, Huang SC: The role of dose distribution gradient in the observed ferric ion diffusion time scale in MRI-Fricke-infused gel dosimetry.

    Magn Reson Imaging 2002, 20:495-502. PubMed Abstract | Publisher Full Text OpenURL

  18. Singer JB, Lewitzky S, Leroy E, Yang F, Zhao X, Klickstein L, Wright TM, Meyer J, Paulding CA: A genome-wide study identifies HLA alleles associated with lumiracoxib-related liver injury.

    Nat Genet 2010, 42:711-714. PubMed Abstract | Publisher Full Text OpenURL

  19. Daly AK, Donaldson PT, Bhatnagar P, Shen Y, Pe'er I, Floratos A, Daly MJ, Goldstein DB, John S, Nelson MR, Graham J, Park BK, Dillon JF, Bernal W, Cordell HJ, Pirmohamed M, Aithal GP, Day CP: HLA-B*5701 genotype is a major determinant of drug-induced liver injury due to flucloxacillin.

    Nat Genet 2009, 41:816-819. PubMed Abstract | Publisher Full Text OpenURL

  20. Kindmark A, Jawaid A, Harbron CG, Barratt BJ, Bengtsson OF, Andersson TB, Carlsson S, Cederbrant KE, Gibson NJ, Armstrong M, Lagerstrom-Fermer ME, Dellsen A, Brown EM, Thornton M, Dukes C, Jenkins SC, Firth MA, Harrod GO, Pinel TH, Billing-Clason SM, Cardon LR, March RE: Genome-wide pharmacogenetic investigation of a hepatic adverse event without clinical signs of immunopathology suggests an underlying immune pathogenesis.

    Pharmacogenomics J 2008, 8:186-195. PubMed Abstract | Publisher Full Text OpenURL

  21. Ozkaya-Bayazit E, Akar U: Fixed drug eruption induced by trimethoprim-sulfamethoxazole: evidence for a link to HLA-A30 B13 Cw6 haplotype.

    J Am Acad Dermatol 2001, 45:712-717. PubMed Abstract | Publisher Full Text OpenURL

  22. Lonjou C, Borot N, Sekula P, Ledger N, Thomas L, Halevy S, Naldi L, Bouwes-Bavinck JN, Sidoroff A, de Toma C, Schumacher M, Roujeau JC, Hovnanian A, Mockenhaupt M: A European study of HLA-B in Stevens-Johnson syndrome and toxic epidermal necrolysis related to five high-risk drugs.

    Pharmacogenet Genomics 2008, 18:99-107. PubMed Abstract | Publisher Full Text OpenURL

  23. Alfirevic A, Vilar FJ, Alsbou M, Jawaid A, Thomson W, Ollier WE, Bowman CE, Delrieu O, Park BK, Pirmohamed M: TNF, LTA, HSPA1L and HLA-DR gene polymorphisms in HIV-positive patients with hypersensitivity to cotrimoxazole.

    Pharmacogenomics 2009, 10:531-540. PubMed Abstract | Publisher Full Text OpenURL

  24. Hung SI, Chung WH, Liou LB, Chu CC, Lin M, Huang HP, Lin YL, Lan JL, Yang LC, Hong HS, Chen MJ, Lai PC, Wu MS, Chu CY, Wang KH, Chen CH, Fann CS, Wu JY, Chen YT: HLA-B*5801 allele as a genetic marker for severe cutaneous adverse reactions caused by allopurinol.

    Proc Natl Acad Sci U S A 2005, 102:4134-4139. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  25. Shear NH, Spielberg SP, Grant DM, Tang BK, Kalow W: Differences in metabolism of sulfonamides predisposing to idiosyncratic toxicity.

    Ann Intern Med 1986, 105:179-184. PubMed Abstract | Publisher Full Text OpenURL

  26. Zielinska E, Niewiarowski W, Bodalski J, Rebowski G, Skretkowicz J, Mianowska K, Sekulska M: Genotyping of the arylamine N-acetyltransferase polymorphism in the prediction of idiosyncratic reactions to trimethoprim-sulfamethoxazole in infants.

    Pharm World Sci 1998, 20:123-130. PubMed Abstract | Publisher Full Text OpenURL

  27. Kaufmann GR, Wenk M, Taeschner W, Peterli B, Gyr K, Meyer UA, Haefeli WE: N-acetyltransferase 2 polymorphism in patients infected with human immunodeficiency virus.

    Clin Pharmacol Ther 1996, 60:62-67. PubMed Abstract | Publisher Full Text OpenURL

  28. Pirmohamed M, Alfirevic A, Vilar J, Stalford A, Wilkins EG, Sim E, Park BK: Association analysis of drug metabolizing enzyme gene polymorphisms in HIV-positive patients with co-trimoxazole hypersensitivity.

    Pharmacogenetics 2000, 10:705-713. PubMed Abstract | Publisher Full Text OpenURL

  29. O'Neil WM, Drobitch RK, MacArthur RD, Farrough MJ, Doll MA, Fretland AJ, Hein DW, Crane LR, Svensson CK: Acetylator phenotype and genotype in patients infected with HIV: discordance between methods for phenotype determination and genotype.

    Pharmacogenetics 2000, 10:171-182. PubMed Abstract | Publisher Full Text OpenURL

  30. Gill HJ, Tjia JF, Kitteringham NR, Pirmohamed M, Back DJ, Park BK: The effect of genetic polymorphisms in CYP2C9 on sulphamethoxazole N-hydroxylation.

    Pharmacogenetics 1999, 9:43-53. PubMed Abstract | Publisher Full Text OpenURL

  31. Wang D, Para MF, Koletar SL, Sadee W: Human N-acetyltransferase 1 *10 and *11 alleles increase protein expression through distinct mechanisms and associate with sulfamethoxazole-induced hypersensitivity.

    Pharmacogenet Genomics 2011, 21:652-664. PubMed Abstract | Publisher Full Text OpenURL

  32. Wang X, Chorley BN, Pittman GS, Kleeberger SR, Brothers J, Liu G, Spira A, Bell DA: Genetic variation and antioxidant response gene expression in the bronchial airway epithelium of smokers at risk for lung cancer.

    PLoS One 2010, 5:e11934. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  33. Koide S, Kugiyama K, Sugiyama S, Nakamura S, Fukushima H, Honda O, Yoshimura M, Ogawa H: Association of polymorphism in glutamate-cysteine ligase catalytic subunit gene with coronary vasomotor dysfunction and myocardial infarction.

    J Am Coll Cardiol 2003, 41:539-545. PubMed Abstract | Publisher Full Text OpenURL

  34. Oliveira CP, Stefano JT, Cavaleiro AM, Zanella Fortes MA, Vieira SM, Rodrigues Lima VM, Santos TE, Santos VN, de Azevedo Salgado AL, Parise ER, Ferreira Alves VA, Carrilho FJ, Correa-Giannella ML: Association of polymorphisms of glutamate-cystein ligase and microsomal triglyceride transfer protein genes in non-alcoholic fatty liver disease.

    J Gastroenterol Hepatol 2010, 25:357-361. PubMed Abstract | Publisher Full Text OpenURL

  35. Gysin R, Kraftsik R, Sandell J, Bovet P, Chappuis C, Conus P, Deppen P, Preisig M, Ruiz V, Steullet P, Tosic M, Werge T, Cuenod M, Do KQ: Impaired glutathione synthesis in schizophrenia: convergent genetic and functional evidence.

    Proc Natl Acad Sci U S A 2007, 104:16621-16626. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  36. Tafazoli S, Spehar DD, O'Brien PJ: Oxidative stress mediated idiosyncratic drug toxicity.

    Drug Metab Rev 2005, 37:311-325. PubMed Abstract | Publisher Full Text OpenURL

  37. Lavergne SN, Kurian JR, Bajad SU, Maki JE, Yoder AR, Guzinski MV, Graziano FM, Trepanier LA: Roles of endogenous ascorbate and glutathione in the cellular reduction and cytotoxicity of sulfamethoxazole-nitroso.

    Toxicology 2006, 222:25-36. PubMed Abstract | Publisher Full Text OpenURL

  38. Choi J, Liu RM, Kundu RK, Sangiorgi F, Wu W, Maxson R, Forman HJ: Molecular mechanism of decreased glutathione content in human immunodeficiency virus type 1 Tat-transgenic mice.

    J Biol Chem 2000, 275:3693-3698. PubMed Abstract | Publisher Full Text OpenURL

  39. Salter AJ: Trimethoprim-sulfamethoxazole: an assessment of more than 12 years of use.

    Rev Infect Dis 1982, 4:196-236. PubMed Abstract | Publisher Full Text OpenURL

  40. Hosomi H, Akai S, Minami K, Yoshikawa Y, Fukami T, Nakajima M, Yokoi T: An in vitro drug-induced hepatotoxicity screening system using CYP3A4-expressing and gamma-glutamylcysteine synthetase knockdown cells.

    Toxicol In Vitro 2010, 24:1032-1038. PubMed Abstract | Publisher Full Text OpenURL

  41. Nichenametla SN, Lazarus P, Richie JP: A GAG trinucleotide-repeat polymorphism in the gene for glutathione biosynthetic enzyme, GCLC, affects gene expression through translation.

    FASEB J 2011, 25:2180-2187. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  42. Nichenametla SN, Ellison I, Calcagnotto A, Lazarus P, Muscat JE, Richie JP: Functional significance of the GAG trinucleotide-repeat polymorphism in the gene for the catalytic subunit of gamma-glutamylcysteine ligase.

    Free Radic Biol Med 2008, 45:645-650. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  43. Gysin R, Riederer IM, Cuenod M, Do KQ, Riederer BM: Skin fibroblast model to study an impaired glutathione synthesis: consequences of a genetic polymorphism on the proteome.

    Brain Res Bull 2009, 79:46-52. PubMed Abstract | Publisher Full Text OpenURL

  44. Hanzawa R, Ohnuma T, Nagai Y, Shibata N, Maeshima H, Baba H, Hatano T, Takebayashi Y, Hotta Y, Kitazawa M, Arai H: No association between glutathione-synthesis-related genes and Japanese schizophrenia.

    Psychiatry Clin Neurosci 2011, 65:39-46. PubMed Abstract | Publisher Full Text OpenURL

  45. Engstrom KS, Wennberg M, Stromberg U, Bergdahl IA, Hallmans G, Jansson JH, Lundh T, Norberg M, Rentschler G, Vessby B, Skerfving S, Broberg K: Evaluation of the impact of genetic polymorphisms in glutathione-related genes on the association between methylmercury or n-3 polyunsaturated long chain fatty acids and risk of myocardial infarction: a case–control study.

    Environ Health 2011, 10:33. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  46. Hashemi M, Hoseini H, Yaghmaei P, Moazeni-Roodi A, Bahari A, Hashemzehi N, Shafieipour S: Association of polymorphisms in glutamate-cysteine ligase catalytic subunit and microsomal triglyceride transfer protein genes with nonalcoholic fatty liver disease.

    DNA Cell Biol 2011, 30:569-575. PubMed Abstract | Publisher Full Text OpenURL

  47. Wang D, Guo Y, Wrighton SA, Cooke GE, Sadee W: Intronic polymorphism in CYP3A4 affects hepatic expression and response to statin drugs.

    Pharmacogenomics J 2011, 11:274-286. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  48. Lucena MI, Garcia-Martin E, Andrade RJ, Martinez C, Stephens C, Ruiz JD, Ulzurrun E, Fernandez MC, Romero-Gomez M, Castiella A, Planas R, Duran JA, De Dios AM, Guarner C, Soriano G, Borraz Y, Agundez JA: Mitochondrial superoxide dismutase and glutathione peroxidase in idiosyncratic drug-induced liver injury.

    Hepatology 2010, 52:303-312. PubMed Abstract | Publisher Full Text OpenURL

  49. Fujimoto K, Kumagai K, Ito K, Arakawa S, Ando Y, Oda S, Yamoto T, Manabe S: Sensitivity of liver injury in heterozygous Sod2 knockout mice treated with troglitazone or acetaminophen.

    Toxicol Pathol 2009, 37:193-200. PubMed Abstract | Publisher Full Text OpenURL

  50. Enomoto A, Itoh K, Nagayoshi E, Haruta J, Kimura T, O'Connor T, Harada T, Yamamoto M: High sensitivity of Nrf2 knockout mice to acetaminophen hepatotoxicity associated with decreased expression of ARE-regulated drug metabolizing enzymes and antioxidant genes.

    Toxicol Sci 2001, 59:169-177. PubMed Abstract | Publisher Full Text OpenURL

  51. Dai Z, Papp AC, Wang D, Hampel H, Wolfgang S: Genotyping panel for assessing response to cancer chemotherapy.

    BMC Med Genomics 2008, 1:24. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  52. Wang D, Papp AC, Binkley PF, Johnson JA, Sadee W: Highly variable mRNA expression and splicing of L-type voltage-dependent calcium channel alpha subunit 1C in human heart tissues.

    Pharmacogenet Genomics 2006, 16:735-745. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1755-8794/5/32/prepub