Table 2

Primer sequences, position, product length, and CpG units used for MassArray quantitative methylation analysis
Genes Forward primer (5′ → 3′)1 Reverse primer (5′ → 3′)2 Position Product length (bp) CpG unit
LINE-1 TTTTATTAGGGAGTGTTAGATAGTGGG CCCCAAAAATAAAACCTACAAAAAC −835–-368 468 24
NKX2-5 AGGAGGGTTTTGGATTTTTTTT ATTTATTCCCAAACCTCTACTCCTC −59–426 486 21
HAND1 GAGGAGATTTGTTGGTTAGATGTTT AATAAAAATTCCAACAATTCCCAAT −886–-414 473 25
TBX20 TTTGAGTGTGTATGTTAGTTTGAGTTT CTCCTATTTTCCCTAAAAAAACCCT −945–-635 311 17

110-mer tag: cagtaatacgactcactatagggagaagg and 2 T7 promoter tag: aggaagagag were added.

Sheng et al.

Sheng et al. BMC Medical Genomics 2012 5:20   doi:10.1186/1755-8794-5-20

Open Data