Table 2

Primers used in this study

Primers

Sequences

Used for


Mstn Ex1F

GGAAACAGCTCCTAACATCAG

Myostatin exon 2 skip PCR

Mstn Ex3R

CTGAGCAGTAATTGGCCTTATATC

Mstn Ex1F1

GATGACGATTATCACGCTAC

Myostatin QPCR

Mstn Ex2R1

GCACAAACACTGTTGTAGGA

Myog Fw

GCCAGACTATCCCCTTCCTC

Myogenin QPCR

Myog Rev

AGGGATGCCCTCTCCTCTAA

Myf5 Fw

CCACCTCCAACTGCTCTGAT

Myf5 QPCR

Myf5 Rev

GCAATCCAAGCTGGATAAGG

Gapdh Fw

CAATGACCCCTTCATTGACC

Gapdh QPCR

Gapdh Rev

GACAAGCTTCCCGTTCTCAG

DMD Ex6F

CTGGCTTTGAATGCTCTCATC

DMD exon 8 skip PCR

DMD Ex11R

GCTGTCAAATCCATCATGTACC

DMD Ex42F

GTGATGACTGAAGACATGCC

DMD Exon 44 skip PCR

DMD Ex45R

TCTGTCTGACAGCTGTTTGC

DMD Ex53F

TTCAGAATCAGTGGGATGAAG

DMD Exon 54 skip PCR

DMD Ex56R

CGTCTTTGTAACAGGACTGC


Kemaladewi et al. BMC Medical Genomics 2011 4:36   doi:10.1186/1755-8794-4-36

Open Data