Table 1

Antisense oligonucleotides used in this study

AON

Targeting

Sequences (5'-3')


AON1

Myostatin exon 2

guuugaugagucucaggauu

AON2

Myostatin exon 2

gccaaauaccagugccu

AON3

Myostatin exon 2

agccaauuuugcaacacugu

h8AON3

Human dystrophin exon 8

guacauuaagauggacuuc

h44AON1

Human dystrophin exon 44

cgccgccauuucucaacag

h51AON1

Human dystrophin exon 51

ucaaggaagauggcauuucu

h54AON1

Human dystrophin exon 54

uacauuugucugccacugg

M23D (+02-18)

Mouse dystrophin exon 23

ggccaaaccucggcuuaccu


Kemaladewi et al. BMC Medical Genomics 2011 4:36   doi:10.1186/1755-8794-4-36

Open Data