Table 2

Primer Sequences and Conditions for qRT-PCR, Bisulfite sequencing and MSP Analysis

Gene symbol

RefSeq mRNA

Primer Forward (5'-->3')

Primer Reverse (5'-->3')

Size (bp)

AT(°C)


Quantitative Real Time PCR (qPCR) assay

ABCA8

NM_007168

CCATCATGGTATCTGGGAGGTT

GCAGGTAATCTTTGCCAAATTTG

77

60

AQP8

AB013456

CACGGGCTGGCTTTGG

CCAGTACGGGAGGAGCATCA

128

60

CLCA4

NM_012128

CAAAATGGCCTATCTCAGTATTCCA

TCGCTTTGGCTTGAAGATTGT

68

60

HPGD1

NM_000860

GCATGGCATAGTTGGATTCACA

AAGCCTGGACAAATGGCATT

83

60

PRDX6

NM_004905

GCCCTTTCAATAGACAGTGTTGAG

ATCGATGATGGGAAAAGGTAACTT

104

60

SLC26A3

NM_000111

ATCGTTGGAACTGATGATGACTTC

CAGCATCATGGATTGTTAAGAAAAA

90

60

STX12

NM_177424

AAGAAAGAGAAACGGCAATTCG

TCATGGCCAAATCTTTAAATATCTGA

75

60

CSE1L

NM_001316

CGGTTCAAACACAATAGCAAGTG

GGATGCAATCAGCTTCTGAAAGA

78

60

HSPH1

NM_00664

AACAAAATCCCAGATGCTGACA

ACCTTTATTTTGGGCTTTTTAGCTT

79

60

NEBL1

HSY1624

ATCCATGAGATCAATGCAGCAT

CATCCTGGGCACTGTAATCGT

73

60

RFC3

NM_002915

CTGAGGGAGACTGCAAATGCT

ACAGCCTTCCACGAACTTCAA

72

60

SLC12A2

NM_001046

AAGGAACATTCAAGCACAGCTAATATT

TGCCATGTAGAGAGCACTAGACACA

86

60

SOX9

NM_000346

ACGCCGAGCTCAGCAAGA

CACGAAGGGCCGCTTCT

70

60

GTF2IRD1

ENST00000265755

AATCTGCAATGATGCCAAGGT

CCGAGACCCGCTTTCTCTT

70

60

MXI1

NM_005962

CGGCACACAACACTTGGTTT

GGCTTTTTCTTTCAGCTTCTTCA

75

60

NR3C2

NM_000901

TTCATTCTCAGTACCAATAAAGCAAGA

GGTTTACTGTTGGATTCCCTTTAAAA

82

60

SGK1

NM_005627

AGGAGCCTGAGCTTATGAATGC

GACGACGGGCCAAGGTT

75

60

NDRG2

NM_201535

CTGACCGAGGCCTTCAAGTACT

GGCGAGTCATGCAGGATGA

66

60

TPX2

NM_012112

AGCCCTTTGTTCCCAAGAAAG

CCAGCTGAAAAGGTTCCTGAA

80

60

UBE2C

NM_181799

TGGAGCTTACTCTGCAACTGTTTC

CCAAATGCCAGAACCCAACATTGATAGTCC

74

60

CCNB1

NM_031966

CCTGGCTAAGAATGTAGTCATGGTAA

GCATGCTTCGATGTGGCATA

83

60

SCNN1B

ENST00000343070

CATTGAAGAATCAGCAGCCAATA

CCCATCCAGAAGCCAAACTG

74

60

FOXM1

U74613

AGCAAGCGAGTCCGCATT

CTGCAGAAGAAAGAGGAGCTATCC

68

60

SGK2

NM_016276

ACATCATTTACAGGGATCTGAAACC

TCCTTGCAGAGGCCAAAATC

87

60

Bisulfite Sequencing Analysis (BSA)

NDRG2

TTTTCGAGGGGTATAAGGAGAGTTTATTTT

CCAAAAACTCTAACTCCTAAATAAACA

320

53

CSE1L

GTTTGGAATTTTAGTATTTTGGGAG

CTCTAACCATACCAACAAACTTCAC

285

60

HSP1

GGAGAGGGTTTGGGTATGTAA

CAAAAAAATAAAATAAACCTAAAAAAC

194

56

PRDX6

TATTTTTTTGTAGGGAGTTGGT

TAACATCCTTCAAACACTATAAACC

279

56

SOX9

TTTTTATTGATTTTTTTTGTAAAAG

ATACCAAAATTTTAATACCTTCTCC

388

53

Methylation-Specific PCR (MSP) assay?

NDRG2_UnM

AGAGGTATTAGGATTTTGGGTATGA

CCACTAAAAAAACAAAAATCTCACC

125

55

NDRG2_M

AGAGGTATTAGGATTTTGGGTACG

GCTAAAAAAACGAAAATCTCGC

123

55

NDRG2_UnM_2

GGTAAATTTATTTGGGTATTGA

CAAAAACAAAATTAACCCTACAAA

210

54

NDRG2_M_2

TAGTGGTAAATTTATTCGGGTATCG

CAAAAACGAAATTAACCCTACGA

214

62

p16-UnM

TTATTAGAGGGTGGGGTGGATTGT

CAACCCCAAACCCACAACCATAA

151

65

p16-M

TTATTAGAGGGTGGGGCGGATCGC

GACCCCCGAACCGCGAACCGTAA

150

68

APC-UnM

GTGTTTTATTGTGGAGTGTGGGTT

CCAATCAACAAACTCCCAACAA

108

63

APC-M

TATTGCGGAGTGCGGGTC

ACCACCTCATCATAACTACCCACA

98

63

MLH1-UnM

TTTTGATGTAGATGTTTTATTAGGTTGT

ACCACCTCATCATAACTACCCACA

124

60

MLH1-M

ACGTAGACGTTTTATTAGGGTCGC

CCTCATCGTAACTACCCGCG

115

60


?UnM = unmethylated sequence; M = methylated sequence.

† AT = annealing temperature.

Piepoli et al. BMC Medical Genomics 2009 2:11   doi:10.1186/1755-8794-2-11

Open Data