Table 1

Primers used in Pyrosequencing and quantitative PCR

Genes

Primers

Sequence

Purpose


CD4

F

R

Sequencing

Assay

5’- TTGAGATTATAYGTATTTGGAAGA -3’

5’- GGGACACCGCTGATCGTTTA ACCTTTATATCTCCTCCTCTCCA -3’

5’- AGTATTTATTGAGAGAAGTT -3’

5’- YGTAGATTGTAGTAGAGTTTGGATYG

GTAGTAAGATYGTGTTGAYGTTTT -3’

Pyrosequencing

GAPDH

F

R

5’-GAGGGTAGTGAAGGCTGCTG-3’

5’-ACCAGGAAACAAGCTTGACG-3’

quantitative PCR

CD4

F

R

5’- TGTCAACGCCGGATGTATAA-3’

5’- CTTGTCCATTGGCTCCTCTC-3’

quantitative PCR


Y stands for C/T. Bold Y in the assay sequence is the CpG sites analyzed.

Luo et al. BMC Proceedings 2011 5(Suppl 4):S7   doi:10.1186/1753-6561-5-S4-S7

Open Data