Table 2

List of primers used in quantitative reverse-transcription PCR (RT-PCR)
Target clone/gene Primers Sequences (5- 3) Product size (bp)
MaPro 1 Forward TGCTTCCACTTCAGTTTTATCAGTCG 266
Reverse GGTTAAGTTCAACTGTGGGGATTTCTAA
MaPro 2 Forward TCTTGAGAGCTTCTGCTGCCAC 271
Reverse TCTTGGATGTTTAATTCGGTGCTGT
MaPro 3 Forward AATCCAACGAAGACATCAGAATCTTCT 246
Reverse CAGGGACTTATCTGGAAGGTCTGGA
MaPro 4 Forward TAGCTTCAATTGCTTCTGGTAGTCTTG 277
Reverse ATCCATGTTTATTCCACATAGTCCATTAC
MaPro 5 Forward ATTTCAAGCGATTGGAAGCTAAGAATC 308
Reverse AATAATCCCAAATAGAATATTACCCATCTTC
MaPro 6 Forward ACTTGGACTGCTGGATACAACAAAC 310
Reverse CGGTGGAGATTCTGGTTTGAAC
MaPro 7 Forward CGGTGGAGATTCTGGTTTGAAC 212
Reverse TTCGGCATCAACAGAATGGTAGATAC
MaPro 8 Forward ACGTTTTATTAGAAAGCCAAGGTAACC 260
Reverse GGTATTTTCGTCGGTGTATTTGTAGCT
MaPro 9 Forward GGGAAAAGGAAACTCTGCATTCG 348
Reverse CATCCATTTTCAGCAGTGTACAGTTCTAT
MaPro 10 Forward CAGATAATGGCTCTACTAATATTGCACTC 243
Reverse AGGGATCTTCACTTCCATTTGTGAATAC
MaPro 11 Forward ATTTGGCTCAATGGAGGACCTG 217
Reverse CAGCGGTATTATCATCAGTGTAAGAGT
MaPro 12 Forward CCACCTACAAACCCCAAGGAGAC 268
Reverse GCGAAAGAGTTGTCTTCCCAGACT
MaPro 13 Forward CAGCTCTTTTAACAGAAGGAGCTACAC 352
Reverse TTTCTGAACTTCGGTATCCACCATA
MaPro 14 Forward AGGGTATCTTCGAACAGCTCTTCG 319
Reverse CATTGGGACAAGAGACTGAACAGTC
MaPro 15 Forward AGCCTTGGAATGGAAATACTTTCGCTG 319
Reverse CCAACACAGTATCCGTTAGAGCTACAG
MaPro 16 Forward ACTCACGGATAGAACAATGCTCTTGC 314
Reverse TTAAAGTGCTTGCGAGCCACTTCC
MaPro 17 Forward TTGCAAGTTTCCTCTGGATTTGAATC 327
Reverse TCCGTATATAAGTTCAATTGTGGCATC
β-tubulin Forward GTATGATCATTGATAACGAAGCCCTCTACG 323
Reverse TCTGGGATCGGCGGCGCACATCATG

Seo et al.

Seo et al. BMC Veterinary Research 2013 9:10   doi:10.1186/1746-6148-9-10

Open Data