Table 2

Nucleotide sequence of PCR primers used for the construction of FMDV O/HN/CHA/93 full-length cDNA clone
Name Nucleotide Sequence (5′ → 3′) Nucleotide Position (nt)
Z1 AGACTAGTtaatacgactcactataT7promoterGGGTTG 1–20
AAAGGGGGCGCTAGGGT
Z1′ GAGGAGGGGGGGGGGGGGGGTGAAAG 363–388
Z2 CTTTCACCCCCCCCCCCCCCCTCCTC 363–388
Z2′ GAAGCAACAGTGCTGCTACT 721–740
Z3 CGCGCCGTCGCTTGAGGAAG 560–579
Z3′ GGGTCGGAGCTCCTCCTTGATAGA 5433–5456
Z4 AGCCACCTCTTCAGAACGTCTACC 5242–5265
Z4′ ACGCGGCCGCTTTTTTTTTTTTTTTTTTTTT 3′ end
Ztu1 GGAGAGCGAGTCAGAT
    A
TCTTCTTCACTACA
4221–4251
Ztu1′ TGTAGTGAAGAAGA
    T
ATCTGACTCGCTCTCC
4221–4251
Ztu2 GAAAACGCCTGAGGC
    C
GCCGCACACTGCATT
2967–2997
Ztu2′ AATGCAGTGTGCGGC
    G
GCCTCAGGCGTTTTC
2967–2997

Restriction enzyme sites introduced during clone construction are boxed. Mutated nucleotides are underlined and in bold.

Li et al.

Li et al. BMC Veterinary Research 2012 8:57   doi:10.1186/1746-6148-8-57

Open Data