Table 1

The primer sequences used for RT-PCR
Name Sequence Length (bp) Tm°C
CD34

F:5′GTGCCACAACATCAAAGACG 3′

R: 5′GGAGCACATCCGTAGCAGGA 3′

239 60
VEGFR-2

F: 5′ GGTCGCATGAACATGAAGAA3′

R: 5′ TTGGTAGGGTTTGTAAGGAC3′

248 58
α-MSA

F: 5′AGCACCACTGAATCCCAAAG3′

R: 5′AGTCCAGGGCCACATAACAC3′

347 58
GAPDH

F:5′ TAAAGGCGAGATGGTGAAAG 3′

R: 5′ ACGCTCCTGGAAGATAGTGAT 3′

244 60

Bai et al.

Bai et al. BMC Veterinary Research 2012 8:54   doi:10.1186/1746-6148-8-54

Open Data