Table 1

Primers used for Real-time qPCR

Gene symbol

Forward primer

Reverse primer

Optimum annealing temp. (°C)

Optimum annealing time (sec)


DSP

CAGACTCACCGAAGAGGAAA

CTGCTGTGAAGTCTGGGAGT

61

7


MAG

TGCCATCGTCTGCTACATTA

CAGTCGCCTCTCACTCTCAT

60

6


PCDH19

CTTTCACATCACTGCACTCG

GTGTGTTGGGAGGTGAGTTC

61

6


HPRT

AGCTTGCTGGTGAAAAGGAC

TTATAGTCAAGGGCATATCC

59

6


RPS19

CCTTCCTCAAAAAGTCTGGG

GTTCTCATCGTAGGGAGCAAG

61

10


Primers sequences used in this study and their annealing optimal temperature and time. The mRNA sequences of key genes were obtained from NCBI database. Primers were designed using PRIMER3 software (free on-line access) and checked using Oligo Calculator (free on-line access) and Primer-Blast (NCBI database). HPRT and RPS19 genes were used as non-regulated reference genes for normalization of target gene expression [19,20].

Król et al. BMC Veterinary Research 2012 8:35   doi:10.1186/1746-6148-8-35

Open Data