Table 1

Cell surface, adipogenic, osteogenic, chondrogenic and neurogenic markers analysed by RT-qPCR
Genes Accession number Primer sequences Amplicon size (bp)
Forward (5’ → 3’) Reverse (5’ → 3’)
Cell Surface Markers
CD29 AF349461 GTGCCCGAGCCTTCAATAAAG CCCGATTTTCAACCTTGGTAATG 87
CD34 AB021662 TGGGCATCGAGGACATCTCT GATCAAGATGGCCAGCAGGAT 107
CD45 NM_001206523 CCTGGACACCACCTCAAAGCT TCCGTCCTGGGTTTTATCCTG 101
CD73 BC114093 TGGTCCAGGCCTATGCTTTTG GGGATGCTGCTGTTGAGAAGAA 115
CD90 BC104530 CAGAATACAGCTCCCGAACCAA CACGTGTAGATCCCCTCATCCTT 96
CD105 NM_001076397 CGGACAGTGACCGTGAAGTTG TGTTGTGGTTGGCCTCGATTA 115
Differentiation Markers
PPARG NM_001100921 GCCCTGGCAAAGCATTTGTA TGTCTGTCGTCTTTCCCGTCA 94
SCD1 AJ001048 CCCAGCTGTCAGAGAAAAGG GATGAAGCACAACAGCAGGA 115
IL6 FJ409227.1 CAGCAAGGAGACACTGGCAG TGATCAAGCAAATCGCCTGAT 101
COL1A1 AF129287 CCTGCGTACAGAACGGCCT ACAGCACGTTGCCGTTGTC 93
BGLAP DQ418490 CCCAGGAGGGAGGTGTGTG CTAGACCGGGCCGTAGAAGC 99
BGN NM_001009201.1 AACATGAACTGCATTGAGATGGG GCGAAGGTAGTTGAGCTTCAGG 93
LUM NM_173934.1 AAGCAATTGAAGAAGCTGCACA TTAGTGAGCTGCAGGTCCACC 92
NES 194665083 CAAATCGCCCAGGTCCTG GCCTCTAGGAGGGTCCTGTATGT 95
NEFM 194669578 GCTCGTCATCTGCGAGAATACC CACCCTCCAGGAGTTTCCTGTA 91
NELF 27806522 CGCTATGCAGGACACAATCAAC GGGTCTCCTCACCTTCCAAGA 161
TUBB3 116004470 GACCTCGAGCCTGGAACCAT GCCCCACTCTGACCAAAGATG 92
MAP2 194664873 TGTCCCAGTGGAGGAAGGTTT TCTTGTCTAGTGGCTCGGCTG 95
PRNP BC119821 CGCAGAAGCAGGACTTCTGAA TGGATTTGTGTCTCTGGGAAGA 86
Housekeeping genes
G6PDH2 AJ507200 TGACCTATGGCAACCGATACAA CCGCAAAAGACATCCAGGAT 76
HPRT3 EF078978 AGGTGTTTATTCCTCATGGAGTAATTATG GGCCTCCCATCTCCTTCATC 79

GenBank accession numbers of the sequences used for primer design. Primer sequences (F: Forward and R: Reverse) and the length of the amplicon in base pairs (bp).

1 Primers described in Dervishi et al. [60].

2 Primers described in García-Crespo et al. 2005 [61].

3 Primers described in Lyahyai et al. 2010 [62].

Lyahyai et al.

Lyahyai et al. BMC Veterinary Research 2012 8:169   doi:10.1186/1746-6148-8-169

Open Data