Table 1

Primers used for real-time qPCR

Gene symbol

Forward primer

Reverse primer

Optimum annealing temp. (°C)

Optimum annealing time (sec)


CCL2

CTCCAGTCACCTGCTGCTAT

CACAGCTTCTTTGGGACACT

60

4


CCL3

CCAGGTCTTCTCACCATTTG

AGATAATACCGGGCTTGGAG

60

5


CD163

ATGTCCAGTGTCCAAAAGGA

CATGTGATCCAGGTCTCCTC

61

6


CSF1R

TGCAGTTTGGGAAGACTCTC

TGTGGACTTCAGCATCTTCA

60

4


HIF1

GATTGCAGCTCCATCTCCTA

TCCTTTTCCTGCTCTGTTTG

58

5


IL18

GATATGCCCGATTCTGACTG

GCCTGGAACACTTCTCTGAA

60

9


MMP9

CGACTACGACCAGGACAAAC

AAGCCCCACTTCTTGTCTCT

61

8


VEGF-C

CAGCAACACTACCACAGTGC

CTCCAGAATTTGAGGCAAAA

61

5


Wnt7b

GCGGAGGGCTGTGTATAAGA

GTCCCCTACTTTGCGGAACT

59

5


HPRT

AGCTTGCTGGTGAAAAGGAC

TTATAGTCAAGGGCATATCC

59

6


RPS19

CCTTCCTCAAAAAGTCTGGG

GTTCTCATCGTAGGGAGCAAG

61

10


Primers sequences used in this study and their annealing optimal temperature and time. The mRNA sequences of key genes were obtained from NCBI database. Primers were designed using PRIMER3 software (free on-line access) and checked using Oligo Calculator (free on-line access) and Primer-Blast (NCBI database). Primers sequences are listed in Table 1. HPRT and RPS19 genes were used as non-regulated reference genes for normalization of target gene expression [3,9]

Król et al. BMC Veterinary Research 2012 8:16   doi:10.1186/1746-6148-8-16

Open Data