Table 2

Primers used for qRT-PCR
Name 5’ – 3’ Direction Position Gen bank No.
oct3/4-1 GCTCCTGAAGCAGAAGAGGA sense 453–472 XM_538830
oct3/4-2 GCTGAACACCTTCCCAAAGA anti-sense 540–559 XM_538830
sox2-1 CCCACCTACAGCATGTCCTA sense 1177–1196 XM_545216
sox2-2 GGAGTGGGAGGAGGAGGTAA anti-sense 1299–1318 XM_545216
nanog-1 CCCAACTCTAGGGACCCTTC sense 22–41 XM_543828
nanog-2 CAGATCCATGGAGGAAGGAA anti-sense 156–175 XM_543828
β-actin GCCAACCGTGAGAAGATGACT sense 339–360 AF021873
β-actin CCCAGAGTCCATGACAATACCAG anti-sense 446–468 AF021873

Takemitsu et al.

Takemitsu et al. BMC Veterinary Research 2012 8:150   doi:10.1186/1746-6148-8-150

Open Data