Table 1

The primers
Gene (Accession No.) Primers (5′-3′) Product size
SBD-1(U75250)
F GGCTCCATCACCTGCTCCTC 206 bpa
R CGTCTTCGCCTTCTGTTACTTCTT
β-actin(U39357)
F GTCACCAACTGGGACGACA 208 bp
R AGGCGTACAGGGACAGCA

a bp, base pairs.

Wen et al.

Wen et al. BMC Veterinary Research 2012 8:143   doi:10.1186/1746-6148-8-143

Open Data