Table 3

Primers used in the cRT-PCR assays
cRT-PCR Assay Name Primer Names Sequence 5' to 3' and Nucleotide Location (nt) Genbank Accession Number Reference
ERAV 5′UTR ERAV 5′UTR F TCAGCCCCCTGTCATTGACT (341-360) NC_003982 This study
ERAV 5′UTR R TGRaTCAGGGCTGTAACCA (769-786)
ERAV Poly ERAV Poly F TGGATGAAGTGGTTTTTGC (6384-6402)
ERAV Poly R CAGTCAAAGCCTGGTTGTCA (6502-6521)
ERAV Poly2 ERAV Poly F TGGATGAAGTGGTTTTTGC (6384-6402)
ERAV Poly R2 ACTCTCATTGCATCAGCTGC (6977-6996)
ERBV 5′ UTR ERBV 5′UTR F TTTCGTTCCWbCTTTAGCRaGG (349-368) NC_003983
ERBV 5′UTR R TCAGATCCGCACTCTATGAAG (764-784)
ERBV OUTER1 ERBV OUTER F TTTTGATGCTTCACATTCTCC (7986-8006) [27]
ERBV OUTER R CGCTGTACCCTCGGTCCTACTC (8746-8767)
ERBV OUTER2 ERBV OUTER F TTTTGATGCTTCACATTCTCC (7986-8006)
ERBV INNER R GCCTCGGCGAGTGAAGAG (8721-8739)
ERBV INNER1 ERBV INNER F CTTACTAYcGAATGTGARGGGGC (8117-8138)
ERBV INNER R GCCTCGGCGAGTGAAGAG (8721-8739)
ERBV INNER2 ERBV INNER F CTTACTAYGAATGTGARGGGGC (8117-8138)
ERBV OUTER R CGCTGTACCCTCGGTCCTACTC (8746-8767)
ERBV Poly1 ERBV Poly F TTGAGTTGACCCTTCTGCA (7409-7427) This study
ERBV Poly R TCATACTCTGAAATGRaKdTCCATTG (7530-7553)
ERBV Poly2 ERBV Poly F TTGAGTTGACCCTTCTGCA (7409-7427)
ERBV Poly R2 GCTGAACCAATGCCTAATCC (7879-7898)

a R represents A or G.

b W represents A or T.

c Y represents C or T.

d K represents G or T.

Lu et al.

Lu et al. BMC Veterinary Research 2012 8:120   doi:10.1186/1746-6148-8-120

Open Data