Table 2

Primers and probes used in the rRT-PCR assay developed by Quinlivanet al. (2010)
rRT-PCR Assay Name Target Genes (GenBank Accession Number) Primer or Probe Namesa Sequence 5' to 3' and Nucleotide Location Length of Fragment (bp)
ERAV 5'-UTR of ERAV (NC_003982) ERAV 468F CCAGGTAACCGGACAGCG (468-485) 118
ERAV 569R GGCAGCGCTACCACAGG (569-585)
ERAV 508b FAMb-CATTGCTCTGGATGGTGT-MGBc (508-525)
ERBV 5'-UTR of ERBV (NC_003983) ERBV 77F TGATGCTTGGCTCTCAGAAA (77-96) 132
ERBV 189R GCAAACGACCAACACATCAA (189-208)
ERBV 171b FAMb-CTTCCAACTAAACCC-MGBc (171-185)

aF = Forward primer. R = Reverse primer. Pr = Probe.

bReporter dye (FAM; 6-carboxyfluorescein) labeled nucleotide.

cNonfluorescent quencher dye (MGB™; minor groove binding) labeled nucleotide.

Lu et al.

Lu et al. BMC Veterinary Research 2012 8:120   doi:10.1186/1746-6148-8-120

Open Data