Table 2

Primers used in qPCR assays
Genbank acc. Gene Primer sequence (5’-3’) Function Amplicon (bp) Primer efficiency
BU694011 Keratin 14 (Krt14)

F: CAAGGTGGTGATCGTCACAG

R: TGGGACCTTAAGAAGCGTGT

Cytoskeleton, cell shape 83 1.91
DW572073 Interleukin 22 (IL22)

F: GGAGAAGCAGGACAAGCATC

R: ATAGCACAGCCGTGTTCCTT

Immune 93 1.89
209733777 MHC class I (MHCI)

F: CTCAGTCACGCAAGAGCAAG

R: AGCCATGTTTCCACTGAAGG

Immune: antigen presentation 111 2.04
BT047112 E3 ubiquitin-protein ligase LINCR (Lincr)

F: CTGGGGACACCTTCAGACAT

R: TACGCATAGCTCCACACCAG

Immune: effector 114 1.89
DY692748 Type-2 ice-structuring protein (AFP2)

F: GGTTGCAGCAGCACCTAAA

R: CCGAGGAGTGTTCACAAACAT

Immune: lectin 100 1.90
EG833741 Cytochrome b558 alpha-subunit (p22phox)

F: GGCACCAGCGTAGAAAGAAC

R: GCAGATCGCTGCATGTAGAA

Immune: oxidative burst 111 2.02
223647763 Arginase-2, mitochondrial (Arg2)

F: GACAGGCTCGGCATTCAGA

R: AAAGACGGGTCCATCGCAT

Immune, amino acid metabolism 110 2.05
CA060324 Annexin A1 (ANXA)

F: GTCAGAATCTTGGTCCTGGTTC

R: ACTGCCGTAGTGAAGTGTGCT

Inflammation, exocytosis 98 2.04
DW531828 Cysteine dioxygenase type 1 (CDO1)

F: TCATTGCTCTCGCTCTGCT

R: GAGTTATTGCCAATGAGCTTCAG

Metabolism: amino acids 82 2.00
DY730337 Sulfate transporter (Sult)

F: AGGCAAAAGAGATCCCAGGT

R: CCCAATGTCAATACCGCTCT

Metabolism: bile, glutathione, xenobiotics 113 2.01
CA041487 Fatty acyl-CoA hydrolase, medium chain (Acot)

F: GGTCCCTCTTCAGGTGTTGA

R: TTTGCTCGTACAGGGTCTCC

Metabolism: fatty acids 121 1.97
DW533963 Fatty acid-binding protein, intestinal (FABP2a2)

F: CAGCTACGATGGAGTCGAAGCCA

R: GGTTGTAAAATGTTCAGTGTCAC

Metabolism: fatty acids 139 1.96
EG934966 Cytochrome P450 24A1 (CYP24A1)

F: GCGTGTTACCCAGGATGAGT

R: GGGAAATTCTCCTCGTCCAT

Metabolism: steroids 105 1.96
DY728977 Cytochrome P450 2 M1 (CYP2M1)

F: TCAGTCCCACCTCTGTACCC

R: AATTTGGGATCAGCAAGCA

Metabolism: xenobiotic 118 1.97
DW532464 Aquaporin-8 (Aqp8)

F: GTTGGCATAGTTCTCCTTTGATG

R: TTTCAACCCTCCCTTCACC

Water channel 148 1.96
AF321836 Elongation factor 1A (EF1A)

F: GTGCTGTGCTTATCGTTGCT

R: GGCTCTGTGGAGTCCATCTT

Translation factor 148 1.91
BT050045 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

F: AAGTGAAGCAGGAGGGTGGAA

R: CAGCCTCACCCCATTTGATG

Glycolytic enzyme 96 1.89
BT043501 Hypoxanthine phospho-ribosyltransferase 1(HPRTI)

F: CCGCCTCAAGAGCTACTGTAAT

R: GTCTGGAACCTCAAACCCTATG

Purine metabolism 255 1.99
BG936649 RNA polymerase II (RNAPOLII)

F:CCAATACATGACCAAATATGAAAGG

R: ATGATGATGGGGATCTTCCTGC

DNA transcription 157 1.85

Kortner et al.

Kortner et al. BMC Veterinary Research 2012 8:101   doi:10.1186/1746-6148-8-101

Open Data