Table 1

Primers for RT-qPCR candidate genes were designed using Primer3 software [44] and based on bovine sequences obtained from the NCBI database.

Gene

Sequence 5' → 3'

Amplicon Size

NCBI Accession


IL1β

F:

CAGTGCCTACGCACATGTCT

167 bp

NM_174093

R:

CCAGGGATTTTTGCTCTCTG

IL2

F:

GTGAAGTCATTGCTGCTGGA

101 bp

NM_180997

R:

GGCGCGTAAAAGTCAAATGT

IL4

F:

CTGCCCCAAAGAACACAACT

165 bp

EU276069

R:

TCGTCTTGGCTTCATTCACA

IL8

F:

TGGGCCACACTGTGAAAATTC

92 bp

[16]

R:

CCTTCTGCACCCACTTTTCC

IFNγ

F:

TTCAGAGCCAAATTGTCTCC

205 bp

[89]

R:

AGTTCATTTATGGCTTTGCGC

TNFα

F:

TGGAGGGAGAAGGGATTCTT

140 bp

AF011926

R:

CCAGGAACTCGCTGAAACTC

Lymphotoxin

F:

GCTGCATCCCTAAGAACAGC

141 bp

BC149732

R:

CATCCGGCTCAAAAATCAGT

TLR4

F:

TGGTAAACCCCAGAGTCCAG

164 bp

NM_174198

R:

GCACAATGCTTGGTACATGG

NFkB1

F:

GCACCACTTATGACGGGACT

148 bp

NM_001076409

R:

TCCTCATCCCAGGAGTCATC

NFkB2

F:

ATCTGAGCATTGTGCGACTG

131 bp

NM_001102101

R:

CTTCAGGTTTGAGGCTCCAG

GRα

F:

CCATTTCTGTTCACGGTGTG

132 bp

AY238475

R:

CTGAACCGACAGGAATTGGT

Fas

F:

AGTTGGGGAGATGAATGCTG

171 bp

NM_174662

R:

CCTGTGGATAGGCATGTGTG

Haptoglobin

F:

TGGTCTCCCAGCATAACCTC

185 bp

BC109668

R:

AGGGTGGAGAACCACCTTCT

CD62L

F:

CCGATTGCTGGACTTACCAT

194 bp

NM_174182

R:

CCAAGTCCACACCCCTTCTA

p21

F:

TCCAAGGACTTTTTCCATTTGC

75 bp

[25]

R:

TCTGACTCCTTCAGCTGTTATTCAA

BPI

F:

TTCAGAAATGATCCAAACATGAAAC

81 bp

[25]

R:

GCCCTTGGAAGAAACAATTCC

ACTB

F:

ACTTGCGCAGAAAACGAGAT

123 bp

BT030480

R:

CACCTTCACCGTTCCAGTTT

SDHA

F:

AACTGCGACTCAACATGCAG

132 bp

NM_001034034

R:

TGTCGAACGTCTTCAGATGC

GAPDH

F:

GGGTCATCATCTCTGCACCT

176 bp

DQ402990

R:

GGTCATAAGTCCCTCCACGA


O'Loughlin et al. BMC Veterinary Research 2011 7:45   doi:10.1186/1746-6148-7-45

Open Data