Table 1

Genes and real-time amplification products

Gene symbol

Gene name

Accession no.

Gene function*

Primer

Amplicon size (bp)

PCR efficiency


    Target genes

SCD

stearoyl-CoA desaturase

XM_543968.2

synthesis of unsaturated fatty acids

Forward:

CTCTACGGATATCGCCCTTACG

106

1.93

Reverse:

GAAAGGAGTGGTGGTAGTTGTGG

TMEM47

transmembrane protein 47

NM_001003045.1

cellular component - plasma membrane

Forward: TGGTGGGTTTGATTTCTATCTGC

123

1.94

Reverse:

TGAACTTGATTGGGTAAAGGACC

ATP5A1

ATP synthase

XM_861390.1

catalyzes ATP synthesis

Forward:

TCCATGACGGAACTGATGAA

165

1.94

Reverse: ACTGAAGTGGAGCAGCATCA

CALM 2

calmodulin2

XM_859583.1

calcium ion binding

Forward:

GATGAAATGATCAGGGAAGCA

178

1.93

Reverse:

AGCAGGGGGAAACCTTTTAC

UBE2V2

TMEM189-UBE2V1

XM_544068.2

small conjugating protein ligase activity

Forward:

AGGAGGAAAAATGCAGCACA

144

1.92

Reverse:

AACACACATGCTTCCACAGC

ZNF 227

zinc finger protein 227

XM_850112.1

nucleic acid binding, zinc ion binding

Forward:

CATCTTCCCTTCAAGCCAGA

119

2.1

Reverse:

TTTCGAAGTGTCTCCATCTCA

LOC488837

similar to T05C3.2

XM_545955.2

apoptosis, protein-protein interactions**

Forward:

CCGGAAAATTGCTAACATTGA

115

1.91

Reverse:

CAGCTTCTCTTGGGCTTCTG

RIMBP2

RIMS binding protein 2

XM_543356.2

interaction in synaptic-vesicle release and presynaptic voltage-gated calcium channels***

Forward:

CAGCTTCTGAGACAAGGCTTCC

124

1.97

Reverse:

TCGGGTCGTAATCATACAGGG

GLT1

solute carrier family 1 member2

NM_001003138

synaptic clearance of glutamate

Forward:

GGTCATCCTGGTCTTGGCTA

259

1.74

Reverse:

CTCCGTCACAGTCTCGTTCA

    Endogenous control genes

LOC482993 (RPL32)

similar to 60S ribosomal protein L32

XM_540107

protein binding, structural constituent of ribosome

Forward:

ATGCCCAACATTGGTTACGG

Reverse:

CTCTTTCCACGATGGCTTTG

181

1.84

HNRNPH1

heterogeneous nuclear ribonucleoprotein H1

XM_852029.1

RNA binding

Forward:

CTCACTATGATCCACCACG

Reverse:

TAGCCTCCATAACCTCCAC

151

1.81


* Function by NCBI Entrez Gene or Gene Ontology for given gene or homologue

** Possible functions linked to conserved domains NACHT and WD40

*** Function by [43]

VĂ¥ge et al. BMC Veterinary Research 2010 6:34   doi:10.1186/1746-6148-6-34

Open Data