Table 2

Virulence genes and PCR primers used to test screen Salmonella isolates.

Virulence gene

Pathogenicity island

Gene function

Broad action

Primer sequence (5' to 3')


prgH

SPI-1

Type III secretion system apparatus

Invasion of macrophages

F: GCCCGAGCAGCCTGAGAAGTTAGAAA

R: TGAAATGAGCGCCCCTTGAGCCAGTC

sopB

SPI-1

Type III secreted effector protein

Invasion of macrophages

F: CGGACCGCCCAGCAACAAAACAAGAAGAAG

R: TAGTGATGCCCGTTATGCGTCAGTGTATT

sopE

SPI-1

Type III secreted effector protein

Invasion of macrophages

F: TCAGTTGGAATTGCTGTGGA

R: TCCAAAAACAGGAAACCACAC

invA

SPI-1

Type III secretion system apparatus

Invasion of macrophages

F: CTGGCGGTGGGTTTTGTTGTCTTCTCTATT

R: AGTTTCTCCCCCTCTTCATGCGTTACCC

sitC

SPI-1

Iron transport

Invasion of macrophages/iron acquisition

F: CAGTATATGCTCAACGCGATGTGGGTCTCC

R: CGGGGCGAAAATAAAGGCTGTGATGAAC

spiC

SPI-2

Type III secretion system

Survival in macrophages

F: CCTGGATAATGACTATTGAT

R: AGTTTATGGTGATTGCGTAT

sifA

SPI-2

Type III secreted effector protein

Survival in macrophages

F: TTTGCCGAACGCGCCCCCACACG

R: GTTGCCTTTTCTTGCGCTTTCCACCCATCT

misL

SPI-3

Involved in intramacrophage survival

Survival in macrophages

F: GTCGGCGAATGCCGCGAATA

R: GCGCTGTTAACGCTAATAGT

orfL

SPI-4

Adhesin/autotransporter

Survival in macrophages/colonisation

F: GGAGTATCGATAAAGATGTT

R: GCGCGTAACGTCAGAATCAA

pipD

SPI-5

Type III secreted effector-associated with SPI-1 system

Enteritis

F: CGGCGATTCATGACTTTGAT

R: CGTTATCATTCGGATCGTAA

iroN

NA

Siderophore (iron acquisition)

Associated with iron usage

F: ACTGGCACGGCTCGCTGTCGCTCTAT

R: CGCTTTACCGCCGTTCTGCCACTGC

pefA

NA

Fimbriae

Movement

F: GCGCCGCTCAGCCGAACCAG

R: CAGCAGAAGCCCAGGAAACAGTG


Hughes et al. BMC Veterinary Research 2008 4:4   doi:10.1186/1746-6148-4-4

Open Data