Abstract
Background
Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte.
Results
We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. α-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan δ, titin cap, α-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed.
Conclusion
The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.
Background
Dilated cardiomyopathy (DCM) is a myocardial disease characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. This disease has been described in different species and multiple genes have been found in the human [1], mouse [2] and hamster [3] causing DCM. These genes mainly encode cyto-skeletal components of the cardiac myocytes and can be divided into sarcomeric and extra-sarcomeric proteins. The identified sarcomeric proteins involved in DCM include α-cardiac actin, encoded by ACTC [4], cysteine-rich protein 3 (CSRP3) [5], LIM-domain binding factor 3 (LDB3, also known as Cypher or ZASP) [6], myosin heavy polypeptide 7 (MYH7) [7], titin cap (TCAP) [8], α-tropomyosin (TPM1), troponin I (TNNI3) [9], troponin T (TNNT2) [7], titin (TTN) [10] and vinculin (VCL) [11]. The extra-sarcomeric proteins implicated in DCM are encoded by the genes including caveolin 1 (CAV1) [2], desmin (DES) [12], lamin A/C (LMNA) [13], phospholamban (PLN) [14] and sarcoglycan δ (SGCD) [3]. The genes encoding all of the above proteins are located on the autosomal chromosomes. X-linked genes implicated in DCM include dystrophin (DYS) [15] and tafazzin (TAZ) [16]. In addition, mitochondrial dysfunction and mitochondrial DNA (mtDNA) mutations have been associated with maternally inherited DCM [17]. Furthermore, DCM has also been described with arrhythmias, with mutations in genes encoding sodium [18] and potassium channels [19].
DCM has been described in many different breeds of mostly giant and large dogs, including the Dobermann [20], Great Dane [21], Newfoundland [22] and Irish Wolfhound [23]. Clinical variation exists in the presentation and progression of DCM between different dog breeds and breed specific variation has also been found in histological findings in DCM-affected hearts tissue [24]. Since clinical DCM may be a late onset disease, following a long pre-symptomatic course, dogs are often used for breeding before the disease becomes apparent [25]. So far, no causative mutation has been discovered in canine DCM. The phenotype of the adult onset forms of canine DCM in most breeds is consistent with a defect in components of the cytoskeleton.
Of the 14 autosomal DCM candidate genes for the dog, ACTC, CAV1, CSRP3, DES, LDB3, LMNA, MYH7, PLN, SGCD, TCAP, TNNI3, TNNT2, TPM1 and VCL, genomic information and/or polymorphic markers were already available for ACTC [26,27], DES [28], PLN [29], SGCD [30] and TPM1 [31]. In this article, we describe a complete set of polymorphic markers for these 14 candidate genes for canine DCM. The markers, both microsatellites and Single Nucleotide Polymorphisms (SNPs), provide a useful tool to perform linkage and association studies between each of these genes and DCM in the different dog breeds. Furthermore, we present the annotation of 14 candidate genes in the canine genome, which will facilitate mutation screening of these genes.
Genomic Annotation
The 14 canine DCM candidate genes were identified on the canine genome by means of a BLAST analysis [32], using available canine and human DNA sequences as a query (Table 1). The exons were identified based on the corresponding human exon sequence (retrieved from [33], Table 1). Each gene was found to be covered by 1 to 5 contigs of the Canis familiaris genome build 1.1. (Additional file 1 and Table 1). CAV1 was covered by 2 neighbouring contigs and the 3 coding exons matched the human ones. Exon 1 of the dog seemed to have an extra nucleotide (T, position 336 of [Genbank: AAEX01048547]) compared to human exon 1 of CAV1. However, this nucleotide was not present in the single trace file of the Canis familiaris Trace Archive [34] covering this sequence. Canine DES had 1 amino acid less than the human protein. The canine LDB3 protein is 67 amino acids shorter than human LDB3. Canine LMNA had 1 amino acid extra compared to the human protein. Exon 24 of canine MYH7 seemed to have 1 bp extra (G, bp 7,902 of [Genbank: AAEX01041100]), however, this nucleotide was not present in any of 11 Canis familiaris trace sequences covering this position. Without this extra nucleotide, canine exon 24 matched the human exon. Canine TNNI3 had 1 amino acid extra compared to the human protein. For TNNT2, coding exons 1, 15 and 16 could not be recognized in canine genomic contigs. TNNT2 exon 6 showed 1 extra bp compared to human (G, bp 5622 of [Genbank: AAEX01013360]), however, this nucleotide was not found in the 2 traces covering this DNA sequence. Without this additional bp, exon 6 matched the corresponding human exon exactly in length. Exon 12 had 1 codon less than the human gene. Exon 13 was located at the end of genomic contig [Genbank: AAEX01013360] and although its terminal 2 putative bp were not included in this contig, exon 12 seemed to match the human exon. For the remaining candidate genes, ACTC, CSRP3, PLN, SGCD, TCAP, TPM1 and VCL, the annotated canine exons matched the corresponding human exons exactly. We could not identify non-coding exons. Apparently, the conservation of these exons is too low for identification purposes. Complementary DNA sequencing is necessary to identify these non-coding exons. All of the predicted introns of the 14 candidate genes started and ended with the canonical GT and AG dinucleotides, respectively [35]. Even though a high quality DNA sequence of the canine genome has recently become available, it has not yet been fully annotated.
Table 1. Assignment, genomic location and the degree of sequence conservation compared to human of the canine DCM candidate genes.
Additional file 1. Overview of the genomic organization of the canine ACTC (A), CAV1 (B), CSRP3 (C), DES (D), LDB3 (E), LMNA (F), MYH7 (G), PLN (H), SGCD (J), TCAP (K), TNN-I3 (L), TNN-T2 (M), TPM1 (N) and VCL (P) gene, in build 1.1 of the canine genome. The size of each coding exon, its actual location in bp in the respective genomic contig, 10 bp of DNA sequence at the 5'end and 3'end of the exon, 10 bp of the flanking intron and the intron sizes are listed. In case the coding sequence of a gene was covered by multiple Canis familiaris genomic contigs, the size of the intron covered by more than one contig was based on information of the respective chromosome. For the exons containing the start and the stop codon, the number of coding bp is listed as ORF (open reading frame); the location of the respective codon is listed between brackets.
Format: DOC Size: 286KB Download file
This file can be viewed with: Microsoft Word Viewer
The conservation of the coding region of each gene was assessed by BLAST comparison of the cDNA and derived amino acid sequences with those of human (at the website of NCBI [36], BLASTN and TBLASTX analysis, respectively). The percentages of identity at the nucleotide level varied between 88 and 95% (Table 1). At the amino acid level, the percentages of identity varied in general between 90–100%, except for the canine LDB3 protein, that was 79% identical to the human protein. The canine ACTC protein appeared to be identical to the human protein. In LDB3, a relatively low percentage of identity was found between the canine and human gene, both at the cDNA and the protein level. This was caused by the large (inframe) loss of part of exons (i.e. 4, 7, 8 and 9) compared to the human gene: the canine gene had 660 codons, the human gene had 734 codons.
The chromosomal position of the 14 canine candidate genes can be found in Table 1.
When analysing the location of the genes in the dog genome (Table 1), using the canine-human comparative map of Guyon et al. [37], each was found to be syntenic to the human location.
Polymorphisms
Single Nucleotide Polymorphism detection
We used denaturing high-performance liquid chromatography (DHPLC) analysis for the detection of SNPs in amplified genomic canine DNA fragments. Polymorphisms were assessed in DNA from Newfoundland dogs. For each gene, several DNA fragments of approximately 500 bp were selected based on melting profile (analyzed with WAVEMAKER™ software from Transgenomic) with a maximum of 2 melting temperatures covering each product. The melting behaviour of a fragment depends on the fragment's DNA sequence. Primers were designed using Primer3 [38] and annealing temperatures of the PCRs were optimized (Table 2). Touchdown PCR amplification of these fragments was performed with DNA of Newfoundland dogs (n = 16; 8 unrelated founders of a pedigree of Newfoundland dogs and 8 family members), using HotStartTaq DNA Polymerase (Qiagen). The Touchdown (TD) PCR program consisted of a denaturing step of 5 min at 95°C, followed by 14 cycles of 95°C 30 sec, Ta +7°C 30 sec, 72°C 20 sec, with a Ta decrease of 0.5°C/cycle, followed by 25 cycles of 30 sec at 94°C, 30 sec at Ta°C, 30 sec at 72°C, followed by a final extension at 72°C for 2 min (Ta in Table 2). Subsequently, a heteroduplex formation step was carried out to allow formation of hetero- and homo-duplex products; the PCR products were heated 5 min at 95°C, after which the temperature was decreased gradually (38 cycles of 1 min, temperature decreasing 1.5°C/cycle), followed by a final step of 5 min at 10°C. Mutation analysis of the PCR products, based on the presence of heteroduplexes, followed on a WAVE instrument (WAVE Nucleic Acid Fragment Analysis System, Transgenomic). Multiple WAVE patterns of a single PCR fragment in different dogs pointed at existence of both homoduplexes and heteroduplexes and, therefore, indicated potential presence of SNPs in the fragment. In that case, the PCR fragment (of at least of 2 dogs per WAVE pattern) was cleaned (Shrimp Alkaline Phosphatase/ExoI) and the DNA sequence was obtained to determine the identity of the SNPs, by a commercial company (Lark Technologies™, UK).
Table 2. Single Nucleotide Polymorphisms in the DCM candidate genes. For each SNP its origin, its primers and the PCR conditions, and its informativity are listed.
Twenty-eight SNPs were discovered by WAVE analysis (Table 2). No indication of the presence of a SNP was found in WAVE fragments of LMNA, MYH7 and TNNI3 (3, 5 and 3 fragments analyzed, respectively). One new SNP, TCAP SNP 29,957 T/C in genomic contig [Genbank: AAEX01022011], was found when we resequenced a TCAP fragment in a group of Newfoundland dogs. WAVE analysis of this fragment had not indicated presence of a potential SNP – although the obtained DNA sequences showed that both homozygous and heterozygous animals were among the dogs used for WAVE analysis. Conversely, sometimes WAVE analysis indicated potential presence of SNPs, yet sequencing of dogs with different WAVE patterns did not confirm these. This could be due to the sequencing procedure used.
In search of additional SNPs for canine ACTC and DES, genomic DNA fragments containing SNPs annotated by others (Table 2) were resequenced. After PCR amplification of these fragments, 1 μl of 1:15 diluted PCR product was used in a Tercycle big dye reaction with the F-PCR-primer for the ACTC SNP and a HPLC-purified M13 F-primer (5'-GTTTTCCCAGTCACGAC-3') for the DES SNPs. The Tercycle consisted of 25 cycles of 30 sec at 96°C, 15 sec at 55°C and 2 min at 60°C. After purification (Sephadex TM G50 Superfine, Amersham Biosciences), each product was processed with an ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems). Five SNPs (ACTC 5,452G/A; DES 19,196C/T and 19,105G/A; LDB3 25,452A/G and TCAP 29.957 T/C) were identified by resequencing areas of earlier described SNPs (Table 2).
Of the total of 33 identified SNPs, 4 were in coding regions (DES 15,006C/T, LDB3 14,090C/T, TCAP 29,957T/C and TNNT2 10,466C/T). These exonic SNPs, however, did not cause polymorphisms at the amino acid level. Comparing the 33 newly discovered SNPs to the dog SNP database of the Broad Institute [39] showed 25 of our SNPs to be new, the remaining 8 SNPs matched SNPs present in the Broad database (see Table 2). This indicates that, in addition to the many SNPs that have become available by random sequencing of the dog genome, many more canine SNPs exist. Our limited search for SNPs in 14 DCM candidate genes took place in a single breed, the Newfoundland dog. However, a high percentage of SNPs found in one breed can be expected to be polymorphic in other breeds too [40]. All identified SNPs were submitted to dbSNP and the respective accession numbers are listed in Table 2.
Detection of microsatellite polymorphisms
Simple DNA sequences composed of CA, GAAA or GA repeats were identified in the genomic contigs that contain the candidate genes or in neighbouring contigs. For VCL, a polymorphic microsatellite became available through personal communication with P.Stabej (Table 3; a repeat was obtained from BAC RP81-251B5, isolated using methods as described in [28] with an overgo probe based on murine VCL exon 17, F-overgo CCAAGGTCAGAGAAGCCTTCCAAC, R-overgo AAGTCAGGCTCCTGAGGTTGGAAG). Primers were designed from the DNA sequence flanking the repeats and the forward primer was fluorescently labelled with 6-FAM or HEX. For some microsatellites, a 3-primer protocol was used for the PCR amplification (Table 3), using an M13-tailed (GTTTTCCCAGTCACGAC----- (5'-3')) F-primer, a 6-FAM-labelled M13 primer (GTTTTCCCAGTCACGAC (5'-3')) and a R-primer. Genotyping PCR reactions were incubated 12 min at 94°C, followed by 35 cycles of 10 sec at 94°C, 15 sec at Ta°C and 30 sec at 72°C, and a final step of 20 min at 72°C (Ta in Table 3). An ABI PRISM ® 3100 Genetic Analyzer (Applied Biosystems) was used for genotyping and allele sizes were determined with Genescan Analysis 3.7 and Genotyper 3.7 software (Applied Biosystems). Eleven polymorphic microsatellites were developed for ACTC (2 markers), CAV1 (1), CSRP3 (1), LMNA (2), MYH7 (1), TNNI3 (3) and VCL (1) (Table 3). The markers, mostly CA-repeats, showed multiple allele sizes (2–6 alleles/marker) in a group of 16 Newfoundland dogs (Table 3). To describe the informativeness of our microsatellite markers, the polymorphism information content (PIC) was obtained based on the genotypes of unrelated founders of a family of Newfoundland dogs (Table 3). According to [41], 2 of the 11 newly designed microsatellites were considered highly informative (PIC>0.50), 7 reasonable informative (0.25<PIC<0.50) and 2 slightly informative (PIC<0.25) in the Newfoundland founder dogs. Besides the 11 polymorphic microsatellites, 2 other markers were found to be monomorphic in the group of Newfoundland dogs, but might be polymorphic in other breeds. This was a MYH7 CA-repeat (position 11,730 of [Genbank: AAEX010141100]) and a TNNI3 CA-repeat (position 17,739 of [Genbank: AAEX01053915]. An already available microsatellite for TPM1 [31] was shown to be highly informative in our group (Table 3).
Table 3. Polymorphic microsatellite markers for canine DCM candidate genes1
The distance between the microsatellite and the corresponding gene was derived from the dog genome build 1.1 [42] and can be found in Table 3. This distance varied from zero for an intragenic microsatellite to 179.8 kb. The genomic locations of polymorphic microsatellites, already available for DES, SGCD, TPM1 and VCL, were determined. For DES a CA-repeat [28] was located at position 5,688 of [Genbank: AAEX01055032], 9.0 kb downstream of the stop codon. For SGCD both a GAAA-repeat and a CA-repeat were available [30]. The first was located at position 76,364 of [Genbank: AAEX4801016848], the second at position 42,047 of the same genomic contig and both markers are in intron 7 of SGCD. For TPM1 a GA-repeat [31] was located at position 88,113 of [Genbank: AAEX01008742], 6.5 kb downstream of the stop codon. A polymorphic GAAA-repeat for VCL showed to be located at position 12,680 of [Genbank: AAEX01016406] in the dog genome, 88.6 kb downstream of the stop codon.
Conclusion
With the annotation of these 14 candidate genes for DCM and the identification of polymorphic markers, the genes can be evaluated for the involvement in breed specific DCM. The SNPs and microsatellites presented in this paper are a powerful tool to analyse linkage between the fourteen candidate genes encoding cytoskeletal proteins and DCM in the dog. The annotation of each gene facilitates screening of these genes for mutations in naturally occurring canine DCM in specific breeds, potential models for forms of human DCM.
Authors' contributions
ACW carried out the molecular genetic studies and drafted the manuscript. PAJL participated in the design of the study, helped to draft the manuscript. BAvO participated in the design of the study and was co-applicant for funding. WEO participated in the coordination of the study. JDMcE conceived of the study and was main applicant for funding. She phenotyped the dogs, collected the samples and extracted the genomic DNA.
All authors had read and approved the final manuscript.
Acknowledgements
This study and A.C. Wiersma were supported by a grant from the Kennel Club Charitable Trust Canine Health Foundation Fund, United Kingdom, and by the Faculty of Veterinary Science, University of Liverpool, United Kingdom. Special thanks to Francine Jury of the Centre for Integrated Genomic Medical Research (CIGMR, University of Manchester, United Kingdom) for her help with the WAVE analyses. Thanks to Polona Stabej (Faculty of Veterinary Medicine, University of Utrecht, The Netherlands) for the VCL microsatellite data.
References
-
Burkett EL, Hershberger RE: Clinical and Genetic Issues in Familial Dilated Cardiomyopathy.
Journal of the American College of Cardiology 2005, 45:969-981. PubMed Abstract | Publisher Full Text
-
Zhao YY, Liu Y, Stan RV, Fan L, Gu Y, Dalton N, Chu PH, Peterson K, Ross JJ, Chien KR: Defects in caveolin-1 cause dilated cardiomyopathy and pulmonary hypertension in knockout mice.
Proceedings of the National Academy of Sciences of the United States of America 2002, 99:11375-11380. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Nigro V, Okazaki Y, Belsito A, Piluso G, Matsuda Y, Politano L, Nigro G, Ventura C, Abbondanza C, Molinari AM, Acampora D, Nishimura M, Hayashizaki Y, Puca GA: Identification of the Syrian hamster cardiomyopathy gene.
Human Molecular Genetics 1997, 6:601-607. PubMed Abstract | Publisher Full Text
-
Olson TM, Michels VV, Thibodeau SN, Tai YS, Keating MT: Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.
Science 1998, 280:750-752. PubMed Abstract | Publisher Full Text
-
Knoll R, Hoshijima ML, Bang ML, Hayashi H, Shiga N, Yasukawa H, Schaper W, McKenna W, Yokoyama M, Schork NJ, Omens JH, McCulloch AD, Kimura A, Gregorio CC, Poller W, Schaper J, Schultheiss HP, Chien KR: The cardiac mechanical stretch sensor machinery involves a Z disc complex that is defective in a subset of human dilated cardiomyopathy.
Cell 2002, 111:943-955. PubMed Abstract | Publisher Full Text
-
Arimura T, Hayashi T, Terada H, Lee SY, Zhou Q, Takahashi M, Ueda K, Nouchi T, Hohda S, Shibutani M, Hirose M, Chen J, Park JE, Yasunami M, Hayashi H, Kimura A: A Cypher/ZASP mutation associated with dilated cardiomyopathy alters the binding affinity to protein kinase C.
The Journal of Biological Chemistry 2004, 279:6746-6752. PubMed Abstract | Publisher Full Text
-
Kamisago M, Sharma SD, DePalma SR, Solomon S, Sharma P, McDonough R, Smoot L, Mullen MP, Woolf PK, Wigle ED, Seidman JG, Seidman CE: Mutations in sarcomere protein genes as a cause of dilated cardiomyopathy.
The New England journal of medicine 2000, 343:1688-1696. PubMed Abstract | Publisher Full Text
-
Hayashi T, Arimura T, Itoh-Satoh M, Ueda K, Hohda S, Inagaki N, Takahashi M, Hori H, Yasunami M, Nishi H, Koga Y, Nakamura H, Matsuzaki M, Choi BY, Bae SW, You CW, Han KH, Park JE, Knoll R, Hoshijima M, Chien KR, Kimura A: Tcap gene mutations in hypertrophic cardiomyopathy and dilated cardiomyopathy.
Journal of the American College of Cardiology 2004, 44:2192-2201. PubMed Abstract | Publisher Full Text
-
Murphy RT, Mogensen J, Shaw A, Kubo T, Hughes SS, McKenna WJ: Novel mutation in cardiac troponin I in recessive idiopathic dilated cardiomyopathy.
Lancet 2004, 363(9406):371-372. PubMed Abstract | Publisher Full Text
-
Itoh-Satoh M, Hayashi H, Nishi H, Koga Y, Arimura T, Koyanagi T, Takahashi M, Hohda S, Ueda K, Nouchi T, Hiroe M, Marumo F, Imaizumi T, Yasunami M, Kimura A: Titin mutations as the molecular basis for dilated cardiomyopathy.
Biochem Biophys Res Commun 2002, 291(2):385-393. PubMed Abstract | Publisher Full Text
-
Olson TM, Illenberger S, Kishimoto NY, Huttelmaier S, Keating MT, Jockusch BM: Metavinculin mutations alter actin interaction in dilated cardiomyopathy.
Circulation 2002, 105:431-437. PubMed Abstract | Publisher Full Text
-
Li D, Tapscoft T, Gonzalez O, Burch PE, Quinones MA, Zoghbi WA, Hill R, Bachinski LL, Mann DL, Roberts R: Desmin mutation responsible for idiopathic dilated cardiomyopathy.
Circulation 1999, 100(5):461-464. PubMed Abstract | Publisher Full Text
-
Burke B, Stewart CL: Life at the edge: the nuclear envelope and human disease.
Nature reviews Molecular Cell Biology 2002, 3:575-585. PubMed Abstract | Publisher Full Text
-
MacLennan DH, Kranias EG: Phospholamban: a crucial regulator of cardiac contractility.
Nature Reviews Molecular cell biology 2003, 4:566-577. PubMed Abstract | Publisher Full Text
-
Cohen N, Muntoni F: Multiple pathogenetic mechanisms in X linked dilated cardiomyopathy.
Heart 2004, 90:835-841. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
D'Adamo P, Fassone L, Gedeon A, Janssen EA, Bione S, Bolhuis PA, Barth PG, Wilson M, Haan E, Orstavik KH, Patton MA, Green AJ, Zammarchi E, Donati MA, Toniolo D: The X-linked gene G4.5 is responsible for different infantile dilated cardiomyopathies.
American Journal of Human Genetics 1997, 61:862-886. PubMed Abstract | PubMed Central Full Text
-
Suomalainen A, Paetau A, Leinonen A, Majander A, Peltonen L, Somer H: Inherited idiopathic dilated cardiomyopathy with multiple deletions of mitochondrial DNA.
Lancet 1992, 340:1319-1320. PubMed Abstract | Publisher Full Text
-
McNair WP, Ku L, Taylor MR, Fain PR, Dao D, Wolfel E, Mestroni L, Group FCRR: SCN5A mutation associated with dilated cardiomyopathy, conduction disorder, and arrhythmia.
Circulation 2004, 110:2163-2167. PubMed Abstract | Publisher Full Text
-
Bienengraeber M, Olson TM, Selivanov VA, Kathmann EC, O'Cochlain F, Gao F, Karger AB, Ballew JD, Hodgson DM, Zingman LV, Pang YP, Alekseev AE, Terzic A: ABCC9 mutations identified in human dilated cardiomyopathy disrupt catalytic KATP channel gating.
Nature Genetics 2004, 36:382-387. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Domanjko-Petric A, Stabej P, Zemva A: Dilated cardiomyopathy in Dobermanns, survival, causes of death and pedigree review in a related line.
Journal of Veterinary Cardiology 2002, 4:17-24. Publisher Full Text
-
Meurs KM, Miller MW, Wright NA: Clinical features of dilated cardiomyopathy in Great Danes and results of a pedigree analysis.
Journal of the American Veterinary Medical Association 2001, 218:729-732. PubMed Abstract | Publisher Full Text
-
Tidholm A, Jonsson L: Dilated cardiomyopathy in the Newfoundland: a study of 37 cases (1983-1994).
Journal of the American Animal Hospital Association 1996, 32:465-471. PubMed Abstract
-
Brownlie SE, Cobb MA: Observations on the development of congestive heart failure in Irish wolfhounds with dilated cardiomyopathy.
Journal of Small Animal Practice 1999, 40:371-377. PubMed Abstract
-
Tidholm A, Haggstrom J, Jonsson L: Detection of attenuated wavy fibers in the myocardium of Newfoundlands without clinical or echocardiographic evidence of heart disease.
American journal of veterinary research 2000, 61:238-241. PubMed Abstract | Publisher Full Text
-
Dukes-McEwan J, Borgarelli M, Tidholm A, Vollmar AC, Häggström J: Proposed Guidelines for the Diagnosis of Canine Idiopathic Dilated Cardiomyopathy.
Journal of Veterinary Cardiology 2003, 5:7-19. Publisher Full Text
-
Brouillette JA, Andrew JR, Venta PJ: Estimate of nucleotide diversity in dogs with a pool-and-sequence method.
Mammalian Genome 2000, 11:1079-1086. PubMed Abstract | Publisher Full Text
-
Meurs KM, Magnon AL, Spier AW, Miller MW, Lehmkuhl LB, Towbin JA: Evaluation of the cardiac actin gene in Doberman Pinschers with dilated cardiomyopathy.
American journal of veterinary research 2001, 62:33-36. PubMed Abstract | Publisher Full Text
-
Stabej P, Imholz S, Versteeg SA, Zijlstra C, Stokhof AA, Domanjko-Petric A, Leegwater PA, Van Oost BA: Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.
Gene 2004, 340:241-249. PubMed Abstract | Publisher Full Text
-
Stabej P, Leegwater PA, Stokhof AA, Domanjko-Petric A, Van Oost BA: Evaluation of the phospholamban gene in purebred large-breed dogs with dilated cardiomyopathy.
American journal of veterinary research 2005, 66:432-436. PubMed Abstract | Publisher Full Text
-
Stabej P, Leegwater PA, Imholz S, Versteeg SA, Zijlstra C, Stokhof AA, Domanjko-Petric A, Van Oost BA: The canine sarcoglycan delta gene: BAC clone contig assembly, chromosome assignment and interrogation as a candidate gene for dilated cardiomyopathy in Dobermann dogs.
Cytogenet Genome Res 2005, 111(2):140-146. PubMed Abstract | Publisher Full Text
-
Stabej P: Molecular Genetics of Dilated Cardiomyopathy in the Dobermann Dog. In PhD thesis. University of Utrecht, Faculty of Veterinary Medicine, Dept of Clinical Sciences of Companion Animals; 2005:183.
-
BLAST Dog Sequences section of NCBI BLAST [http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9615] webcite
-
Ensembl [http://www.ensembl.org] webcite
-
NCBI Trace Archive database Mega BLAST search [http://www.ncbi.nlm.nih.gov/blast/mmtrace.shtml] webcite
-
Schott EJ, Robledo JA, Wright AC, Silva AM, Vasta GR: Gene organization and homology modeling of two iron superoxide dismutases of early branching protist Perkinsus marinus.
Gene 2003, 309:1-9. PubMed Abstract | Publisher Full Text
-
NCBI BLAST Assembled Genomes [http://www.ncbi.nlm.nih.gov/BLAST/] webcite
-
Guyon R, Lorentzen TD, Hitte C, Kim L, Cadieu E, Parker HG, Quignon P, Lowe JK, Renier C, Gelfenbeyn B, Vignaux F, DeFrance HB, Gloux S, Mahairas GG, Andre C, Galibert F, Ostrander EA: A 1-Mb resolution radiation hybrid map of the canine genome.
Proceedings of the National Academy of Sciences of the United States of America 2003, 100:5296-5301. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Rozen S, Skaletsky HJ: Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology. Edited by Krawetz S and Misener S. Totowa, NJ, Humana Press; 2000:365-386.
-
Dog SNPs - CanFam 1.0 database, BROAD Institute [http://www.broad.mit.edu/mammals/dog/snp/] webcite
-
Parker HG, Kim LV, Sutter NB, Carlson S, Lorentzen TD, Malek TB, Johnson GS, DeFrance HB, Ostrander EA, Kruglyak L: Genetic structure of the purebred domestic dog.
Science 2004, 304:1160-1164. PubMed Abstract | Publisher Full Text
-
Botstein D, White RL, Skolnick M, Davis RW: Construction of a genetic linkage map in man using restriction fragment length polymorphisms.
American Journal of Human Genetics 1980, 32:314-331. PubMed Abstract | PubMed Central Full Text
-
NCBI Genomic Biology [http://www.ncbi.nlm.nih.gov/Genomes/] webcite





