Table 1

Primers used for PCR
Primer Direction Sequence 5′→3′
hNIS Sense CCCATCGATGGAGGCCGTGGAGACCGG
Anti-sense CCCATCGATGTCAGAGGTTTGTCTCCTGC
GADPH Sense CCCATCGATGTCAGAGGTTTGTCTCCTGC
Anti-sense GGTCATGAGTCCTTCCACGAT

GADPH glyceraldehyde-3-phosphate dehydrogenase, hNIS human sodium iodine symporter.

Belmar-Lopez et al.

Belmar-Lopez et al. BMC Medicine 2013 11:139   doi:10.1186/1741-7015-11-139

Open Data