Table 1

Gene panel.

Gene

GenBank Acc no

function

Primer F

Primer R


Zebrafish


pou5f1

NM_131112,1

pluripotency, homolog of mammalian Oct4

GGTTCGGAAGCCCAGGATT

TGAGCTGAGGGAATGTTTTGC


sox2

NM_213118,1

pluripotency

ACCCCGGAGGAAAACCAA

CCCGGCAGGGTGTACTTG


zic3

NM_001001950,2

pluripotency

CCCTGGGCTGGGACTCA

CTTGAAGGCAGCCGAGTGA


klf4

NM_131723

pluripotency

GAACCACTGCGGGCAAAT

GATGGTGGAGTCAGCATCACA


c-myc

L11710

pluripotency

CGTCAACGCGGCATGA

GATTGTTGCTAGCCTCAAGTCGTA


sall4

NM_001080609

Sall4 activates Pou5f1 expression in vivo and in vitro

CTCCCAGAGACCTTCTTCATCAG

GACCGAACATGCCAGAAGAAA


tert

NM_001083866

pluripotency, downregulation of TERT caused loss of pluripotency and human ESC differentiation

CGACAGCAAACCGAAAAAACTT

CGACTGAATAGCGGCACCAT


mps1 (or tkk)

NM_175042

blastemal proliferation

TGGATGGTTCGCTGAAGCTAA

GGTCACGTCAGGCTGAATCTG


hsp60

NM_181330

fin regeneration

GGTGAGGACGGCACTGCTA

TTCAGCGGTGGACAAGAGAGA


Msxb

NM_131260

regulate the rate of proliferation of blastema cells during fin regeneration

CCAGCAGGTCGCGTGTTC

TCCTGACCATGTCCCATTCTC


hsp90a1

NM_131328

mouse Es cells

TGAACTGATCCCAGACCAGAAA

CAATGCCGGTGTCGATGAT


Xenopus


oct25

M60074

homolog of mammalian Oct4

CCCCAATGTTTCAGGCTTGT

CCACAGGCCGTGCAGACT


oct60

M60075

homolog of mammalian Oct4

CAGAAACACAGCCGGACAGA

CACCCATAGCAGCACAGCAT


oct79

M60076

homolog of mammalian Oct4

CACGACCTGACCTCCTGGTATAC

TGCTGGACCTCCATTAATATTGC


oct91

M60077

homolog of mammalian Oct4

AACGTGACCTCGATTTGCACTA

AACGTGACCTCGATTTGCACTA


sox2

NM_001088222

pluripotency

GCACATGTCGCAACACTATCAGA

GGCAGCGTGCCATTGATC


c-myc

X56870

pluripotency

GGCGGAACGAGCTTAAGTTG

CGCCACCTCGGGTACCT


lin28

NM_001087449

pluripotency

GCCCAGTGTCCAGAGAAAGC

TCCTCAGTGATTGGCTGATCTTC


zic3

NM_001087619

pluripotency

TGCCAGCTCAGGGTACGAAT

TCCTCACTGTTGGCAGAAACC


tert-A

NM_001085633

pluripotency, homolog of human htert

ATATTCTTGCTTCAAGCTTACAGGTTT

CCGCTGGCCAAATGGA


cripto3

AJ864901

pluripotency, homolog of TDGF3

GGAAGATATTGCGAGCTTCATGT

CAATGGCCATGTGGAACAATT


gdf3

NM_001087497

pluripotency

GCTGTTTTACAGACTCTGGTGCAT

GGGCACAGCAAGGCAATG


sall4

AY336983

pluripotency

AGTTCATTGTGCCTCCTACAGTCA

CGCGGTGGCATACTGGTT


dppa2/4

NM_001096099

pluripotency, hypothetical protein equally homolog to dppa2 and dppa4

TGTGACGAGTGTTTTGAGAGGAA

AGACCGACCTCTGCTGCAA


Fut1

AY278679

pluripotency, α1,3/4 fucosyl transferase lewis 1, mouse homolog of ssea1

TGCCACCTTACGAACTTTCTCA

AATCTGTCCCGTTTCACTTTGC


msx1

BC081101

blastema marker

GAGAAAGCACAAAACCAACAGAAA

GGCCAGCAGTTGGGATGTAG


fgf8

NM_001090435

blastema marker

CGACCCACACGCCAAGTTA

TTTAATGCGAACTCTGCTTCCA


lef1

NM_001096734

blastema marker

CCCACTGTCCCCAGGAAGT

GTGGATACCAGCCCAATGGT


ODC

NM_001086698.1

housekeeping gene

TCCATTGAGAGCGTAGGACTTG

GAGGCTCGCCGGTGAAATA


Forward and reverse primers used in quantification of relative expression by qPCR of zebrafish and Xenopus genes. Gene names and accession numbers are specified as well as gene function.

Christen et al. BMC Biology 2010 8:5   doi:10.1186/1741-7007-8-5

Open Data