Table 2

The primers used in this study.

Haplogroup/AMG

Primer

SNP

Length


HVRI-AB

L16017 5'-TTCTCTGTTCTTTCATGGGGA

H16251 5'-GGAGTTGCAGTTGATGTGTGA

Sequencing

235 bp

HVRI-CD

L16201 5'-CAAGCAAGTACAGCAATCAAC

H16409 5'-AGGATGGTGGTCAAGGGA

Sequencing

209 bp

M

10400T 5'-taattaTACAAAAAGGATTAGACTGtgCT

10400C 5'-TACAAAAAGGATTAGACaGAACC

10400R 5'-GAAGTGAGATGGTAAATGCTAG

10400T

149 bp/142 bp

R

L12604 5'-ATCCCTGTAGCATTGTTCG

H12754 5'-GTTGGAATAGGTTGTTAGCG

12705C

151 bp

UK

L12247 5'-TAACAACATGGCTTTCTCAACT

H12377 5'-GAAGTCAGGGTTAGGGTGGT

12308G

132 bp

C

L14318T 5'-CCTTCATAAATTATTCAGCTTCCaACACTAT

L14318C 5'-aaaaagctaCATAAATTATTCAGCTTCCTACtCTAC

H14318R 5'-TTAGTGGGGTTAGCGATGGA

14318C

110 bp/115 bp

C4

L11845 5'- AAGCCTCGCTAACCTCGCC

H12120 5'- GGGTGAGTGAGCCCCATTG

11969A

176 bp

B

L8215 5' ACAGTTTCATGCCCATCGTC '

H8297 5' ATGCTAAGTTAGCTTTACAG

CoII/tRNAlys

9-bp deletion

121 bp/112 bp

R1

L4812 5'- GTCCCAGAGGTTACCCAAG

H4975 5'- CCACCTCAACTGCCTGCTA

4917G

164 bp

R11

L9920 5'- CGCCTGATACTGGCATTTTGT

H101075' -GTAGTAAGGCTAGGAGGGTGTTG

10031C

188 bp

HV

L14668 5'- CATCATTATTCTCGCACGG

H14831 5'- CGGAGATGTTGGATGGGGT

14766T

164 bp

F

3970T 5' taaaaTGTATTCGGCTATGAAGAtTAA

3970C 5' GTGTATTCGGCTATGAAGtATAG

3970R 5' AGTCTCAGGCTTCAACATCG

3970T

70 bp/66 bp

H

L6966 5'-GGCATTGTATTAGCAAACTCAT

H7118 5'-TAGGGTGTAGCCTGAGAATAG

7028C

152 bp

AMG

AMG1 5'-CCTGGGCTCTGTAAAGAATAG

AMG2 5'-CAGAGCTTAAACTGGGAAGCTG

115 bp/121 bp

Paternal hg F

Forward 5' CCACAGAAGGATGCTGCTCA

Reverse r 5' CACACTTTGGGTCCAGGATCAC

M89T

125 bp

Paternal hg K

Forward 5' GGACCCTGAAATACAGAAC

Reverse 5' AAGCGCTACCTTACTTACAT

M9G

128 bp

Paternal hg P

Forward 5' GGGTGTGGACTTTACGAAC

Reverse 5' AAATCCTACTATCTCCTGGC

M45A

129 bp

Paternal hg R1

Forward 5' TTACTGTAACTTCCTAGAAAATTGG

Reverse 5' ATCCTGAAAACAAAACACTGG

M173C

126 bp

Paternal hg R1a1a

Forward 5' CTCTTTAAGCCATTCCAGTCA

Reverse 5' AAACATTACATGAGAAATTGCTG

M198A

113 bp


Li et al. BMC Biology 2010 8:15   doi:10.1186/1741-7007-8-15

Open Data