Table 3

Primers used for PCR amplification and sequencing.

Gene

Description

Primer name

Primer sequence (5'-3')

Reference


16S

16S rDNA

27f

AGAGTTTGATCCTGGCTCAG

[81]

rssur

GAAAGCATCTCTGCGATCCG

[15]

atpA

ATP synthase F1 alpha subunit

atpAf2

ATCAAGCGTTGCACAGATAG

this study

Vitr

CGACTTACCGAAATACCGAC

[33]

atpA536r

GGAAGTGCCGTAAGTGAACC

this study

gltA

citrate synthase

rcit133f

GGTTTTATGTCTACTGCTTCKTG

[10]

rcit1197r

CATTTCTTTCCATTGTGCCATC

[10]

coxA

subunit I of cytochrome C oxidase

coxAf2

ACAGCCGTTGATATGGCTA

this study

coxA1413r

CATATTCCAACCGGCAAAAG

this study

coxA322f

GGTGCTCCTGATATGGCATT

this study

coxAr1

CATATTCCAGCCGGCAAAAG

this study


For AtpA, the primers used in tandem are atpAf2 as a forward primer and either VitR or atpA536r as reverse primers. For amplification of coxA, the primers used are coxAF2 with coxA1413r or coxA322f with coxAr1.

Weinert et al. BMC Biology 2009 7:6   doi:10.1186/1741-7007-7-6

Open Data