Table 4

New primer sequences designed for this study

Primer name

Sequence (5' to 3')


rbcL-Z1Cus

ATGTCACCACAAACAGARACTAAARC

rbcL-521F

CTATTAAACCWAAATTGGGKTTATC

rbcL-599R

GTAAAATCAAGTCCACCRCGAAG

rbcL-818F

GATTCACTGCAAATACTTCTTTGG

rbcL-910R

GTCTATCAATAACKGCATGCATTG

rbcL-1392R

CTCYTTCCATACCTCACAAGCAG

rps2-J12F

ATATTGGAACATMAAWTTGGAAG

rps2-J662R

CYAATTTGTTMAGAATGAATCG

rps2-J306F

CGGTATGTTAACRAATTGGTCCAC

rps2-J458R

CCCAGATATMTTTGCAAGCGAGC

petD-endF

CAAAATCCATTTCGKCGTCCAG

rps11-C398F

GCCACACAATGGCTGTAGACCTCC


McNeal et al. BMC Biology 2007 5:55   doi:10.1186/1741-7007-5-55

Open Data