Table 2

Quantitative PCR primer sequences used in this study
Gene Direction Primer sequence 5′→3′
CK19 Forward TGAGTGACATGCGAAGCCAATAT
Reverse GCGACCTCCCGGTTCAAT
HPRT Forward TAATGGTGGAGATGATCTCTCAAC
Reverse TGCCTGACCAAGGAAAGC

Yang et al.

Yang et al. BMC Biology 2013 11:86   doi:10.1186/1741-7007-11-86

Open Data