Table 1

Primer sequences
Gene Oligo names Primer sequences 5′-3′
CdICE1-B ACTGGATCCATGCTACCGGAAAACGACA
CdICE1-S TCCCCCGGGAATGGCACCATGATAACCT
zh-F CGGGTACCATGCTACCGGAAAACGACA
zh-R TCCCCGCGGTAATGGCACCATGATAACCT
ICE1 ACTCATATGATGCTACCGGAAAACGACA
ICE21 ACTCATATGACCCCTACAACCACCCCA
ICE85 ACTCATATGTCACCTTCACAATCACACTCAC
ICE121 ACTCATATGTGTGACCCTAGCTTCATTTCCA
ICE471 ACTGGATCCAATGGCACCATGATAACCT
CdICE1 CdICE-F CCTACCCAACAAATGGCAACTA
CdICE-R TCTCTCCACTCTGTCTCAGCGC
CBF1 cbf1-F GTGACGTGTCGCTTTGGAGTTAC
cbf1-R GTGAAGCAAAGAAGTAGAAAACG
CBF2 cbf2-F TCGAGGGAGATGATGACGTGTCC
cbf2-R TATTTTGATTTGTTGCTTATGG
CBF3 cbf3-F CGACGGCGATGATGACGACGT
cbf3-R GCATTTAAGAATAGCCCACAC
COR6.6 cor6.6-F CAGAGACCAACAAGAATGCC
cor6.6-R CGATATACTCTTTCCCGCCT
COR15a cor15a-F AAAGCAGGAGAGGCTAAGGAT
cor15a-R CATGAAGAGAGAGGATATGGATCA
RD29a rd29a-F TAGGAAAGTAAAGGCTAGAGCTAAG
rd29a-R AATCGGAAGACACGACAGG
β-tubulin tubin-F AAGATTCGTCCCACGCG
tubin-R TCCTTTAGCCCAATTGTTACC
U6 U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT
CSD2 CSD2-F AACCCTAACAACATGACACACG
CSD2-R GAACCACAAAGGCTCTTCCAAC
CSD1 CSD1-F AGACCCTGATGACCTCGGAAA
CSD1-R GCCACACACCAGAAGATACAC
miR398 miR398-F TGTGTTCTCAGGTCACCCCT
Uni-miR qPCR Primer From TaKaRa
MIR398a miR398a-F AGAAGAAGAGAAGAACAACAGGAGGTG
miR398a-R TTTAGTAAGGTGAAAAAATGGAACAGG
MIR398b miR398b-F TAACAAGAAGATATCAATATATCATG
miR398b-R ACCATTTGGTAAATGAGTAAAAGCCAGCC
MIR398c miR398c-F TCGAAACTCAAACTGTAACAGTCC
miR398c-R ATTTGGTAAATGAATAGAAGCCACG

Chen et al.

Chen et al. BMC Biology 2013 11:121   doi:10.1186/1741-7007-11-121

Open Data