Table 2

HPV-16, -31 and -33 variants with close sequence similarity at the L1 gene GP5+ primer binding site

Highly similar DNA sequence

Genotype

Locus


5'_acgcagtacaaatatgtcattatgtgctgccata

HPV-16

EU779755

5'_acgcagtacaaatatgtcattatgtgctgccata

HPV-31

EF140820

5'_acgcagtacaaatatgtcattatgtgctgccata

HPV-33

DQ448214

5' tttgttggggtaaccaacta

    tttgttactgttgt

HPV-16

EU779755

5' tttgttggggcaatcagtta

    tttgttactgtggt

HPV-31

EU779751

5' tttgttggggcaatcaggta

    tttgttactgtggt

HPV-33

EU779744


DNA sequences retrieved from the National Center for Biotechnology Information database. The symbol _ and the underlined bases represent the end and the beginning of the GP5+ PCR priming site, respectively. A 34-base sequence shared by HPV-16 and certain HPV-31 (EF140820) and HPV-33 (DQ448214) strains is located immediately downstream of the GP5+ site. A 1- to 4-base difference is present upstream of the GP5+ site between certain variants of HPV-16, HPV-31 (EU779751) and HPV-33 (EU779744).

Lee et al. BMC Clinical Pathology 2009 9:3   doi:10.1186/1472-6890-9-3

Open Data