Table 2

Primers

Loci

Forward Primer

Reverse Primer


D1S508

5'AGCTGGGGAATATATGTNTCATAT3'

5'TGTGGAAGGCCAACTC3'

D1S2734

5'GGTTCAAGGGATTCTCCTG3'

5'TGGCACTCAGACCTCAA3'

D19S219

5'GTGAGCCAAGATTGTGCC3'

5'GACTATTTCTGAGACAGATTCCCA3'

D19S412

5'TGAGCGACAGAATGAGACT3'

5'ACATCTTACTGAATGCTTGC3'


Myal et al. BMC Clinical Pathology 2003 3:6   doi:10.1186/1472-6890-3-6

Open Data