Table 1

Primer sequences
Gene Sequences (forward) Sequences (reverse)
18S 5′ TTCGAACGTCTGCCCTATCAA 3′ 5′ ATGGTAGGCACGGCGACTA 3′
GAPDH 5′ ACAGTCAGCCGCATCTTCTT 3′ 5′ ACGACCAAATCCGTTGACTC 3′
NFI-A 5′ CCAGCGCCCGGCAGTTATGT 3′ 5′ ATTCATCCTGGGTGAGACAGAGCGG 3′
NFI-B 5′ AACCAGCCAGCCTAACGGCA 3′ 5′ TCGCACTGCACTGGGATGGG 3′
NFI-C 5′ GACATGGAAGGAGGCATCTC 3′ 5′ GGGCTGTTGAATGGTGACTT 3′
NFI-X 5′ CCACTGCCCAACGGGCACTTA 3′ 5′ CCGTCACATTCCAGACCCCGGA 3′
SULT1A1 5′ AGGAGTTCATGGACCACAGC3′ 5′ TGAAGGTGGTCTTCCAGTCC3′
siNFI-A 5′ GGUAUUCCGCUGGAAAGUAtt 3′
siNFI-B 5′ AGUGUCAUCUCAACUCGAAtt 3′
siNFI-C 5′ GGACAGGGCGUCUUCCUAAtt 3′
siNFI-X 5′ GAAUCCGGACAAUCAGAUAtt 3′

Yao-Borengasser et al.

Yao-Borengasser et al. BMC Clinical Pathology 2014 14:1   doi:10.1186/1472-6890-14-1

Open Data